MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-02-06, 08:44 EST based on data in: /Users/kwi2002/Downloads/20260114_FastQC_MultiQC

Because this report contains a lot of samples, you may need to click 'Show plot' to see some graphs.

General Statistics

Showing 1502 samples.

Created with MultiQC

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table_table

Sort	Group	Column	Description	ID	Scale
\|\|	Mosdepth	≥ 1X	Fraction of genome with at least 1X coverage	`mosdepth-1_x_pc`
\|\|	Mosdepth	≥ 5X	Fraction of genome with at least 5X coverage	`mosdepth-5_x_pc`
\|\|	Mosdepth	≥ 10X	Fraction of genome with at least 10X coverage	`mosdepth-10_x_pc`
\|\|	Mosdepth	≥ 30X	Fraction of genome with at least 30X coverage	`mosdepth-30_x_pc`
\|\|	Mosdepth	≥ 50X	Fraction of genome with at least 50X coverage	`mosdepth-50_x_pc`
\|\|	Mosdepth	Median	Median coverage	`mosdepth-median_coverage`
\|\|	Mosdepth	Mean Cov.	Mean coverage	`mosdepth-mean_coverage`
\|\|	Mosdepth	Min Cov.	Minimum coverage	`mosdepth-min_coverage`
\|\|	Mosdepth	Max Cov.	Maximum coverage	`mosdepth-max_coverage`
\|\|	Mosdepth	Mb Total Coverage Bases	Total coverage of bases (millions)	`mosdepth-coverage_bases`	base_count
\|\|	Mosdepth	Genome length	Total length of the genome	`mosdepth-length`
\|\|	Picard: VariantCallingMetrics	TiTV ratio (known)	The Transition/Transversion ratio of the passing bi-allelic SNP calls made at SNP-database sites.	`picard_variantcallingmetrics-DBSNP_TITV`	titv_ratio
\|\|	Picard: VariantCallingMetrics	TiTV ratio (novel)	The Transition/Transversion ratio of the passing bi-allelic SNP calls made at non-SNP-database sites.	`picard_variantcallingmetrics-NOVEL_TITV`	titv_ratio
\|\|	Picard: VariantCallingMetrics	InDel ratio (known)	The Insertion / Deletion ratio of the passing bi-allelic SNP calls made at SNP-database sites.	`picard_variantcallingmetrics-DBSNP_INS_DEL_RATIO`	indel_ratio
\|\|	Picard: VariantCallingMetrics	InDel ratio (novel)	The Insertion / Deletion ratio of the passing bi-allelic SNP calls made at non-SNP-database sites.	`picard_variantcallingmetrics-NOVEL_INS_DEL_RATIO`	indel_ratio
\|\|	Picard: VariantCallingMetrics	Called Variants (known)	Total counts of variants in SNP-database sites.	`picard_variantcallingmetrics-total_called_variants_known`	variant_count
\|\|	Picard: VariantCallingMetrics	Called Variants (novel)	Total counts of variants in non-SNP-database sites.	`picard_variantcallingmetrics-total_called_variants_novel`	variant_count
\|\|	Samtools: flagstat	Reads	Total reads in the bam file (millions)	`samtools_flagstat-flagstat_total`	read_count
\|\|	Samtools: flagstat	Reads mapped	Reads mapped in the bam file (millions)	`samtools_flagstat-mapped_passed`	read_count
\|\|	Samtools: flagstat	% Reads mapped	% Reads mapped in the bam file	`samtools_flagstat-mapped_passed_pct`
\|\|	FastQC	Dups	% duplicate reads	`fastqc-percent_duplicates`
\|\|	FastQC	GC	Average % GC content	`fastqc-percent_gc`
\|\|	FastQC	Avg len	Average read length	`fastqc-avg_sequence_length`
\|\|	FastQC	Median len	Median read length	`fastqc-median_sequence_length`
\|\|	FastQC	Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`fastqc-percent_fails`
\|\|	FastQC	Seqs	Total sequences (millions)	`fastqc-total_sequences`	read_count

Mosdepth

Fast BAM/CRAM depth calculation for WGS, exome, or targeted sequencing.https://github.com/brentp/mosdepthDOI: 10.1093/bioinformatics/btx699

Cumulative coverage distribution

Proportion of bases in the reference genome with, at least, a given depth of coverage. Calculated across the entire genome length

For a set of DNA or RNA reads mapped to a reference sequence, such as a genome or transcriptome, the depth of coverage at a given base position is the number of high-quality reads that map to the reference at that position, while the breadth of coverage is the fraction of the reference sequence to which reads have been mapped with at least a given depth of coverage (Sims et al. 2014).

Defining coverage breadth in terms of coverage depth is useful, because sequencing experiments typically require a specific minimum depth of coverage over the region of interest (Sims et al. 2014), so the extent of the reference sequence that is amenable to analysis is constrained to lie within regions that have sufficient depth. With inadequate sequencing breadth, it can be difficult to distinguish the absence of a biological feature (such as a gene) from a lack of data (Green 2007).

For increasing coverage depths (1×, 2×, …, N×), coverage breadth is calculated as the percentage of the reference sequence that is covered by at least that number of reads, then plots coverage breadth (y-axis) against coverage depth (x-axis). This plot shows the relationship between sequencing depth and breadth for each read dataset, which can be used to gauge, for example, the likely effect of a minimum depth filter on the fraction of a genome available for analysis.

Created with MultiQC

Average coverage per contig

Average coverage per contig or chromosome

Created with MultiQC

XY coverage

Created with MultiQC

Picard

Tools for manipulating high-throughput sequencing data.http://broadinstitute.github.io/picard

Variant Calling Metrics

Showing ⁴⁶⁹/₄₆₉ rows and ⁷/₂₇ columns.

Sample Name	Het/Hom Ratio	Total GQ0	Total Het Depth	Total SNPs	dbSNP SNP count	Novel SNPs	Fraction in dbSNP (SNPs)	Ti/Tv ratio (dbSNP)	Ti/Tv ratio (Novel)	Indels (Total)	Indels (Novel)	% in dbSNP (Indels)	Indels (dbSNP)	Indel Ratio (dbSNP)	Indel Ratio (Novel)	Multiallelic SNPs (Total)	Multiallelic SNPs (dbSNP)	Complex Indels (Total)	Complex Indels (dbSNP)	SNP Ref. Bias	Singletons	Total Called	Total Called (known)	Total Called (novel)
S-250505-00334	0.3	21051	1589813	1398161	1198328	199833	0.9	2.1	1.7	165465	26247	0.8	139218	0.9	0.4	782	621	86007	74679	0.6	360349	1650415	1412846	237569
S-250505-00686	0.3	20254	1713579	1672038	1405974	266064	0.8	2.1	0.9	216843	33042	0.8	183801	0.8	0.4	944	761	141376	121821	0.5	495902	2031201	1712357	318844
S-250505-00689	0.5	23617	3250612	2211448	1659515	551933	0.8	2.0	0.6	260753	43586	0.8	217167	0.8	0.4	1426	1170	176412	151827	0.5	842200	2650039	2029679	620360
S-250519-00843	0.3	17473	1186521	1384197	1198280	185917	0.9	2.1	1.3	183145	28805	0.8	154340	0.8	0.4	672	552	115098	99737	0.5	342219	1683112	1452909	230203
S-250603-01359	0.2	17202	1082980	1349445	1139789	209656	0.8	2.0	1.0	175913	26795	0.8	149118	0.8	0.4	602	466	111328	96368	0.5	326996	1637288	1385741	251547
S-250603-01361	0.3	17791	1298180	1393108	1182411	210697	0.8	2.1	1.2	183884	30889	0.8	152995	0.8	0.4	748	587	121018	103757	0.5	358679	1698758	1439750	259008
S-250603-01362	0.3	17453	1375574	1545654	1335224	210430	0.9	2.1	1.2	196192	32523	0.8	163669	0.8	0.4	786	619	120049	101986	0.5	394304	1862681	1601498	261183
S-250603-01364	0.3	19682	1197014	1434048	1256737	177311	0.9	2.1	1.3	196634	30215	0.8	166419	0.8	0.4	696	593	132299	114039	0.5	379117	1763677	1537788	225889
S-250603-01367	0.2	17967	1184454	1358094	1155694	202400	0.9	2.1	1.6	182385	31860	0.8	150525	0.8	0.4	696	558	116127	100070	0.5	330030	1657302	1406847	250455
S-250603-01368	0.3	19289	1688620	1645994	1426633	219361	0.9	2.1	1.5	219742	36595	0.8	183147	0.8	0.4	927	736	140635	120126	0.5	477318	2007298	1730642	276656
S-250603-01369	0.3	21687	1294060	1500618	1328564	172054	0.9	2.1	1.3	203405	31496	0.8	171909	0.8	0.4	838	677	134664	115343	0.5	408855	1839525	1616493	223032
S-250603-01371	0.2	18143	926912	1236846	1074224	162622	0.9	2.1	1.3	167247	25766	0.8	141481	0.8	0.4	535	398	106798	92296	0.5	279277	1511426	1308399	203027
S-250603-01374	0.3	19112	1463433	1542441	1342723	199718	0.9	2.1	1.5	208234	34872	0.8	173362	0.8	0.4	831	639	136441	117126	0.5	423181	1887947	1633850	254097
S-250603-01375	0.5	27705	3250856	2348965	2079249	269716	0.9	2.1	1.4	311928	50921	0.8	261007	0.8	0.4	1615	1334	200386	169817	0.5	915440	2862894	2511407	351487
S-250603-01377	0.3	17975	1251479	1437175	1263430	173745	0.9	2.1	1.5	196534	30985	0.8	165549	0.8	0.4	715	586	129495	111618	0.5	370870	1763919	1541183	222736
S-250603-01378	0.3	24084	1670466	1709303	1513110	196193	0.9	2.1	1.4	228426	36450	0.8	191976	0.8	0.5	988	789	147490	125162	0.5	517472	2086207	1831037	255170
S-250603-01379	0.4	24433	2766420	2185805	1909591	276214	0.9	2.1	1.5	291533	49586	0.8	241947	0.8	0.4	1498	1215	185458	156691	0.5	762601	2664294	2309444	354850
S-250603-01380	0.2	20492	1099111	1409247	1247408	161839	0.9	2.1	1.5	194455	29486	0.8	164969	0.8	0.4	712	591	134662	116161	0.5	348144	1739076	1529129	209947
S-250603-01381	0.3	18423	1088922	1372329	1205884	166445	0.9	2.1	1.6	178007	27580	0.8	150427	0.8	0.4	647	525	111222	95564	0.5	336564	1662205	1452400	209805
S-250603-01383	0.3	23005	1317223	1523073	1363830	159243	0.9	2.1	1.5	214270	32861	0.8	181409	0.8	0.4	850	709	148752	128168	0.5	420516	1886945	1674116	212829
S-250603-01385	0.3	20694	2072954	1805114	1548660	256454	0.9	2.1	1.3	239134	40567	0.8	198567	0.8	0.4	1045	865	154058	132053	0.5	566874	2199351	1880145	319206
S-250603-01387	0.3	21915	1683489	1668180	1453234	214946	0.9	2.1	1.4	229304	36400	0.8	192904	0.8	0.4	893	729	154667	133473	0.5	500894	2053044	1780340	272704
S-250603-01388	0.2	16582	1002309	1233823	1051842	181981	0.9	2.1	1.4	159691	27942	0.8	131749	0.8	0.4	484	410	94291	80623	0.5	263262	1488289	1264624	223665
S-250603-01390	0.3	25272	1568018	1644719	1446612	198107	0.9	2.1	1.2	230447	35929	0.8	194518	0.8	0.4	888	737	163425	141159	0.5	495191	2039479	1783026	256453
S-250603-01393	0.2	18685	936118	1283553	1138309	145244	0.9	2.1	1.5	169141	25939	0.8	143202	0.8	0.4	545	425	103677	88427	0.5	291145	1556916	1370363	186553
S-250603-01396	0.3	25899	1130181	1485594	1339890	145704	0.9	2.1	1.3	212862	31477	0.9	181385	0.8	0.4	792	661	151807	130908	0.5	401881	1851055	1652844	198211
S-250603-01398	0.3	22185	1860996	1739060	1492689	246371	0.9	2.0	1.1	236508	36981	0.8	199527	0.8	0.4	1032	856	157408	136194	0.5	545610	2134008	1829266	304742
S-250603-01401	0.4	29424	1955733	1866307	1660709	205598	0.9	2.1	1.1	267200	40625	0.8	226575	0.8	0.4	1240	1045	195113	167285	0.5	637657	2329860	2055614	274246
S-250603-01402	0.2	16927	1063308	1306197	1111174	195023	0.9	2.1	1.2	172587	28027	0.8	144560	0.8	0.4	559	443	109841	94923	0.5	305054	1589184	1351100	238084
S-250603-01404	0.3	19585	1627423	1625734	1412767	212967	0.9	2.1	1.4	216898	35726	0.8	181172	0.8	0.4	888	698	141196	121450	0.5	473843	1984716	1716087	268629
S-250605-00261	0.3	20210	2007545	1732630	1409565	323065	0.8	2.0	0.8	222974	36776	0.8	186198	0.8	0.4	997	813	146229	126133	0.5	534421	2102830	1722709	380121
S-250605-00294	0.3	25900	1790228	1802493	1522426	280067	0.8	2.1	0.8	236634	35144	0.9	201490	0.8	0.4	996	851	163988	141528	0.5	545981	2204111	1866295	337816
S-250605-00299	0.2	18187	919753	1237966	1061866	176100	0.9	2.1	1.3	167205	26622	0.8	140583	0.8	0.4	623	485	111728	96324	0.5	286510	1517522	1299258	218264
S-250606-00019	0.3	18935	1189741	1409384	1168573	240811	0.8	2.1	0.9	181291	29079	0.8	152212	0.8	0.4	636	497	118156	102064	0.5	358237	1709467	1423346	286121
S-250606-00024	0.3	19820	1343544	1542829	1350518	192311	0.9	2.1	1.4	198193	32905	0.8	165288	0.8	0.4	769	626	122393	103263	0.5	397977	1864184	1619695	244489
S-250606-00029	0.4	29598	1679179	1821995	1628681	193314	0.9	2.1	0.9	248132	34766	0.9	213366	0.8	0.4	970	828	171712	147401	0.5	593073	2242809	1990276	252533
S-250606-00034	0.4	29761	2159661	1975628	1782445	193183	0.9	2.1	1.3	280807	40839	0.9	239968	0.8	0.4	1228	1050	201936	173379	0.5	707485	2459599	2196842	262757
S-250606-00039	0.3	17911	1506466	1538210	1261611	276599	0.8	2.0	0.9	195656	31481	0.8	164175	0.8	0.4	736	604	125234	107678	0.5	417231	1859836	1534068	325768
S-250606-00114	0.3	17591	1090690	1358855	1166311	192544	0.9	2.1	1.3	182214	29057	0.8	153157	0.8	0.4	641	505	118588	102348	0.5	334589	1660298	1422321	237977
S-250606-00438	0.3	19146	1224510	1419920	1257023	162897	0.9	2.1	1.8	195966	30512	0.8	165454	0.8	0.4	708	554	128575	110792	0.5	366322	1745169	1533823	211346
S-250606-00442	0.4	23359	2539106	2083137	1744323	338814	0.8	2.1	0.9	262968	43919	0.8	219049	0.8	0.4	1196	984	164015	138427	0.5	696392	2511316	2102783	408533
S-250609-00223	0.4	35053	2539935	2266936	2081981	184955	0.9	2.1	1.3	318961	48055	0.8	270906	0.8	0.5	1692	1496	228429	193189	0.5	872344	2816018	2547572	268446
S-250609-00510	0.2	16152	1114590	1394736	1206330	188406	0.9	2.1	1.7	189399	32099	0.8	157300	0.8	0.4	737	587	121532	104560	0.5	321490	1706404	1468777	237627
S-250609-00565	0.5	27124	3324732	2267789	1964546	303243	0.9	2.1	1.5	327123	64850	0.8	262273	0.8	0.3	1823	1572	222671	189781	0.5	919640	2819406	2418172	401234
S-250609-00570	0.5	24976	4111621	2385357	2014454	370903	0.8	2.0	1.2	328850	56306	0.8	272544	0.8	0.4	1930	1598	225898	193298	0.6	1003590	2942035	2481894	460141
S-250610-00106	0.3	28580	1455233	1679481	1507222	172259	0.9	2.1	1.0	240378	34173	0.9	206205	0.8	0.5	990	844	176080	151855	0.5	507512	2096929	1866126	230803
S-250610-00211	0.4	29948	2061947	1904693	1584684	320009	0.8	2.0	0.6	253292	38221	0.8	215071	0.8	0.4	1186	1024	181514	155824	0.5	659666	2340685	1956603	384082
S-250613-00040	0.4	29960	2086276	1942122	1769194	172928	0.9	2.1	1.2	279383	40660	0.9	238723	0.8	0.5	1241	1058	199845	171173	0.5	689893	2422591	2180148	242443
S-250613-00110	0.3	20761	1111001	1374659	1131293	243366	0.8	2.0	0.9	178722	28156	0.8	150566	0.8	0.4	706	556	122825	105970	0.5	345186	1676912	1388385	288527
S-250613-00111	0.3	19725	1413291	1517725	1334111	183614	0.9	2.1	1.6	206276	32816	0.8	173460	0.8	0.4	742	595	134753	116224	0.5	412102	1859496	1624390	235106
S-250613-00112	0.4	30010	1848670	1852814	1688627	164187	0.9	2.1	1.4	269990	40046	0.9	229944	0.8	0.5	1226	1028	202184	172988	0.5	634599	2326214	2092587	233627
S-250613-00113	0.3	21996	1060993	1381623	1231052	150571	0.9	2.1	1.4	190422	27997	0.9	162425	0.8	0.4	655	516	131232	113468	0.5	348136	1703932	1507461	196471
S-250613-00114	0.3	19917	1466380	1552147	1335367	216780	0.9	2.1	1.2	207474	31898	0.8	175576	0.8	0.4	825	673	137766	119051	0.5	425476	1898212	1630667	267545
S-250613-00115	0.2	15905	974973	1242921	1085699	157222	0.9	2.1	1.6	168531	28056	0.8	140475	0.8	0.4	589	470	106900	92007	0.5	281514	1518941	1318651	200290
S-250613-00116	0.3	20306	1878928	1805348	1508490	296858	0.8	2.1	1.0	228994	39315	0.8	189679	0.8	0.4	987	819	143506	121503	0.5	520256	2178835	1820491	358344
S-250613-00117	0.3	17312	1469415	1475267	1263892	211375	0.9	2.1	1.4	193278	32323	0.8	160955	0.8	0.4	719	576	114477	98450	0.5	375055	1783741	1523873	259868
S-250613-00119	0.3	17093	1251846	1436088	1259455	176633	0.9	2.1	1.5	191014	29682	0.8	161332	0.8	0.4	708	574	122470	105620	0.5	366589	1750280	1526981	223299
S-250613-00120	0.3	23739	1596260	1796175	1592576	203599	0.9	2.1	1.3	232882	36198	0.8	196684	0.8	0.5	918	756	145058	123154	0.5	510769	2175033	1913170	261863
S-250616-00311	0.3	21430	1774422	1688219	1437757	250462	0.9	2.1	1.1	219362	34584	0.8	184778	0.8	0.4	888	718	140847	120931	0.5	500233	2049316	1744184	305132
S-250616-00494	0.3	23372	1567332	1630527	1387329	243198	0.9	2.1	1.0	216187	33499	0.8	182688	0.8	0.4	914	745	146765	127041	0.5	481288	1994393	1697803	296590
S-250616-00622	0.4	27409	2140976	1956341	1770904	185437	0.9	2.1	1.5	280211	42637	0.8	237574	0.8	0.4	1279	1118	201193	172629	0.5	695121	2439024	2182225	256799
S-250616-00639	0.3	19891	1255749	1458310	1252251	206059	0.9	2.1	1.0	191390	28729	0.8	162661	0.8	0.4	710	563	125564	108550	0.5	381497	1775974	1524025	251949
S-250616-00785	0.4	20276	2029720	1784646	1504360	280286	0.8	2.1	1.0	232472	37363	0.8	195109	0.8	0.4	964	782	151033	129851	0.5	565798	2169115	1830102	339013
S-250616-00786	0.3	17590	1307183	1461530	1286837	174693	0.9	2.1	1.6	196633	31244	0.8	165389	0.8	0.4	712	550	129218	111562	0.5	385495	1788093	1564338	223755
S-250616-00787	0.2	17144	1082315	1331632	1170296	161336	0.9	2.1	1.7	182626	29288	0.8	153338	0.8	0.4	618	470	119139	102904	0.5	320907	1634015	1427008	207007
S-250616-00788	0.3	17177	1344674	1478610	1303199	175411	0.9	2.1	1.7	195184	31988	0.8	163196	0.8	0.4	733	593	121521	103737	0.5	383274	1796048	1570725	225323
S-250616-00789	0.3	20458	1818166	1689347	1464236	225111	0.9	2.1	1.7	230334	38652	0.8	191682	0.8	0.4	978	799	149966	128868	0.5	502485	2070625	1785585	285040
S-250616-00790	0.3	20590	1068436	1357209	1212726	144483	0.9	2.1	1.6	188044	28424	0.8	159620	0.8	0.4	605	489	127293	109802	0.5	336787	1673151	1482637	190514
S-250616-00791	0.3	17756	1167206	1371512	1203894	167618	0.9	2.1	1.5	178954	28693	0.8	150261	0.8	0.4	660	533	112924	96744	0.5	335624	1664050	1451432	212618
S-250616-00792	0.4	32022	2075177	1965037	1746508	218529	0.9	2.1	1.0	281643	41610	0.9	240033	0.8	0.5	1381	1203	212013	181492	0.5	714305	2460074	2169236	290838
S-250616-00793	0.3	17064	1374333	1488182	1266137	222045	0.9	2.1	1.2	194380	31753	0.8	162627	0.8	0.4	770	612	123498	106358	0.5	390830	1806830	1535734	271096
S-250616-00794	0.2	15070	873716	1191725	1036063	155662	0.9	2.1	1.8	159493	26988	0.8	132505	0.8	0.4	584	462	101335	86861	0.5	254140	1453137	1255891	197246
S-250616-00795	0.4	21650	2046784	1814892	1573413	241479	0.9	2.1	1.3	245283	38510	0.8	206773	0.8	0.4	1066	904	164056	141442	0.5	587304	2225297	1922532	302765
S-250616-00796	0.5	35899	2851342	2322677	2155454	167223	0.9	2.1	1.2	354538	52994	0.9	301544	0.8	0.5	2046	1838	281767	239572	0.5	1023526	2961028	2698408	262620
S-250616-00797	0.3	18627	1410903	1566971	1365937	201034	0.9	2.1	1.4	204550	34756	0.8	169794	0.8	0.4	748	600	124681	105352	0.5	386116	1896950	1641683	255267
S-250616-00798	0.3	18692	1597053	1598845	1386873	211972	0.9	2.1	1.7	218129	37004	0.8	181125	0.8	0.4	863	698	142928	122588	0.5	459230	1960765	1691284	269481
S-250616-00809	0.3	30198	1503283	1684889	1539158	145731	0.9	2.1	1.4	245262	36576	0.9	208686	0.8	0.5	998	871	181718	155716	0.5	531130	2112867	1904431	208436
S-250617-00233	0.5	32438	2547659	2137306	1932576	204730	0.9	2.1	1.2	312856	46949	0.8	265907	0.8	0.5	1542	1345	233339	199767	0.5	841698	2685043	2399595	285448
S-250617-00285	0.3	17623	1232450	1417562	1262949	154613	0.9	2.1	1.7	189021	28395	0.8	160626	0.8	0.4	688	564	120352	103975	0.5	362494	1727623	1528114	199509
S-250617-02155	0.2	16158	1111432	1333748	1180672	153076	0.9	2.1	1.9	179932	28017	0.8	151915	0.8	0.4	667	512	113672	97873	0.5	319196	1628019	1430972	197047
S-250618-01279	0.3	19044	1631708	1594359	1386059	208300	0.9	2.1	1.6	215196	35692	0.8	179504	0.8	0.4	918	705	140002	120400	0.5	450711	1950475	1686668	263807
S-250618-01293	0.3	21065	1678991	1672967	1442216	230751	0.9	2.1	1.2	224987	35389	0.8	189598	0.8	0.4	899	733	147278	127146	0.5	494400	2046131	1759693	286438
S-250618-01294	0.4	21457	2469503	1921821	1608868	312953	0.8	2.0	1.2	254698	42339	0.8	212359	0.8	0.4	1160	975	165870	142409	0.5	643255	2343549	1964611	378938
S-250618-01295	0.3	18450	1530913	1548906	1339913	208993	0.9	2.1	1.6	209977	35763	0.8	174214	0.8	0.4	854	651	136774	117476	0.5	419518	1896511	1632254	264257
S-250619-01389	0.3	17357	1264115	1417379	1244778	172601	0.9	2.1	1.8	189582	30424	0.8	159158	0.8	0.4	684	536	120515	103760	0.5	356682	1728160	1508232	219928
S-250623-00666	0.4	29873	2106675	2067387	1891401	175986	0.9	2.1	1.5	285717	43274	0.8	242443	0.8	0.5	1316	1119	193996	164238	0.5	721922	2548416	2299201	249215
S-250623-00667	0.3	21665	1912748	1771493	1564261	207232	0.9	2.1	1.4	241372	36738	0.8	204634	0.8	0.4	961	783	159014	136800	0.5	559704	2172840	1906478	266362
S-250623-00668	0.4	23315	3200558	2167529	1881348	286181	0.9	2.1	1.5	291604	47734	0.8	243870	0.8	0.4	1443	1177	192668	164290	0.5	818890	2653244	2290685	362559
S-250623-00669	0.3	22342	1666926	1684837	1488099	196738	0.9	2.1	1.3	225913	34688	0.8	191225	0.8	0.4	938	763	145384	124670	0.5	508043	2057072	1804757	252315
S-250623-00670	0.2	17748	1003786	1325004	1154517	170487	0.9	2.1	1.2	170982	25385	0.9	145597	0.8	0.4	611	492	108511	93643	0.5	316032	1605108	1394249	210859
S-250623-00671	0.4	32179	1905906	1910595	1751899	158696	0.9	2.1	1.3	278538	40419	0.9	238119	0.8	0.5	1217	1062	209467	179742	0.5	671930	2399817	2170822	228995
S-250623-00672	0.3	18391	1268487	1448785	1266946	181839	0.9	2.1	1.4	192467	29610	0.8	162857	0.8	0.4	663	544	126736	109322	0.5	377309	1768651	1539669	228982
S-250623-00673	0.3	20059	1717934	1677883	1468214	209669	0.9	2.1	1.5	223662	35124	0.8	188538	0.8	0.4	862	734	146958	126526	0.5	499539	2049365	1784012	265353
S-250623-00674	0.3	21291	1819521	1738829	1489760	249069	0.9	2.1	1.2	229037	35332	0.8	193705	0.8	0.4	1022	843	151501	130574	0.5	531898	2120389	1814882	305507
S-250623-00675	0.3	25630	1370983	1584632	1416456	168176	0.9	2.1	1.1	219985	32150	0.9	187835	0.8	0.5	841	728	154789	133513	0.5	457956	1960247	1738532	221715
S-250623-00676	0.3	18213	1116283	1401574	1245774	155800	0.9	2.1	1.6	190898	28890	0.8	162008	0.8	0.4	644	538	125675	108808	0.5	352027	1718791	1517128	201663
S-250623-00677	0.3	28515	1287765	1673826	1536305	137521	0.9	2.1	1.3	240316	33245	0.9	207071	0.8	0.5	874	773	174240	150475	0.5	466836	2089256	1894624	194632
S-250623-00679	0.4	20783	2183879	1876105	1632469	243636	0.9	2.1	1.4	249218	40567	0.8	208651	0.8	0.4	1096	855	162490	139137	0.5	617652	2288909	1981112	307797
S-250623-00680	0.3	18827	1238221	1475870	1319806	156064	0.9	2.1	1.7	199983	30165	0.8	169818	0.8	0.4	716	579	130650	112980	0.5	391664	1807219	1603183	204036
S-250623-00681	0.2	15943	818765	1184468	998629	185839	0.8	2.1	1.3	142540	22940	0.8	119600	0.8	0.4	464	364	81366	69991	0.5	232542	1408838	1188584	220254
S-250623-00682	0.3	20044	1821064	1700622	1481906	218716	0.9	2.1	1.7	229420	36849	0.8	192571	0.8	0.4	967	798	149788	129009	0.5	502827	2080797	1804284	276513
S-250623-00683	0.3	20362	1194712	1447586	1288897	158689	0.9	2.1	1.5	188129	27691	0.9	160438	0.8	0.4	639	519	116821	100816	0.5	353984	1753175	1550670	202505
S-250623-00684	0.3	18718	1353125	1577714	1378680	199034	0.9	2.1	1.6	206043	33886	0.8	172157	0.8	0.5	810	631	126731	107132	0.5	409806	1911298	1658600	252698
S-250623-00685	0.2	17291	1100528	1395089	1209105	185984	0.9	2.1	1.7	181962	31656	0.8	150306	0.8	0.4	629	482	109948	92741	0.5	317821	1687628	1452634	234994
S-250623-00686	0.3	19617	1048759	1362527	1211874	150653	0.9	2.1	1.6	188622	29103	0.8	159519	0.8	0.4	680	547	128243	110414	0.5	341992	1680072	1482354	197718
S-250623-00687	0.3	17921	1418838	1477848	1257648	220200	0.9	2.1	1.3	198122	34118	0.8	164004	0.8	0.4	730	591	127238	109120	0.5	393061	1803938	1531363	272575
S-250624-00049	0.4	20222	1927258	1759182	1560121	199061	0.9	2.1	1.6	228352	34441	0.8	193911	0.8	0.4	948	797	147578	127312	0.5	564379	2136060	1882141	253919
S-250624-00523	0.3	20366	1855194	1695097	1439704	255393	0.8	2.1	1.3	219152	36508	0.8	182644	0.8	0.4	900	725	132345	114258	0.5	491286	2047494	1737331	310163
S-250625-00890	0.4	21228	2111461	1830623	1578558	252065	0.9	2.1	1.2	244219	39339	0.8	204880	0.8	0.4	1067	860	157822	135793	0.5	582496	2233731	1920091	313640
S-250626-00449	0.5	24412	3268552	2183757	1862751	321006	0.9	2.1	1.4	302590	53051	0.8	249539	0.8	0.4	1653	1366	204820	174982	0.5	850974	2692820	2288638	404182
S-250626-00583	0.4	21973	2422300	1931202	1647608	283594	0.9	2.1	1.3	257224	41814	0.8	215410	0.8	0.4	1212	1009	168696	144909	0.5	655619	2358334	2008936	349398
S-250626-00839	0.5	27583	4390837	2600461	2274550	325911	0.9	2.1	1.6	359474	65154	0.8	294320	0.8	0.4	2246	1855	235657	198077	0.5	1109448	3197838	2768802	429036
S-250627-00861	0.4	23467	2301423	2044676	1805543	239133	0.9	2.1	1.5	272942	46608	0.8	226334	0.8	0.4	1344	1100	170650	143531	0.5	660668	2489612	2176508	313104
S-250627-00911	0.4	23056	2878545	2133777	1855647	278130	0.9	2.1	1.5	283443	46882	0.8	236561	0.8	0.4	1413	1184	178558	152941	0.5	785829	2597191	2246333	350858
S-250627-00978	1.1	32397	11316870	3501300	3071613	429687	0.9	2.0	1.2	530405	92251	0.8	438154	0.8	0.5	5100	4574	429309	364328	0.6	2332706	4466114	3878669	587445
S-250630-00532	0.3	17295	1463093	1458224	1252988	205236	0.9	2.1	1.6	176136	28579	0.8	147557	0.8	0.4	727	574	96565	83182	0.5	364423	1731652	1484301	247351
S-250630-00861	0.7	35783	5149737	2781223	2479719	301504	0.9	2.0	1.1	415437	68336	0.8	347101	0.8	0.5	2943	2581	321580	273446	0.5	1470542	3521183	3102847	418336
S-250701-00032	0.3	22392	1983119	1776300	1558693	217607	0.9	2.1	1.7	240530	37420	0.8	203110	0.8	0.4	1046	842	157972	136688	0.5	564966	2175848	1899333	276515
S-250701-00046	0.6	29032	5723235	2922621	2503958	418663	0.9	2.1	1.3	398552	71842	0.8	326710	0.8	0.4	2664	2267	270426	227768	0.5	1417800	3594263	3060703	533560
S-250701-00084	0.6	29075	4845519	2809345	2478593	330752	0.9	2.1	1.5	382064	64717	0.8	317347	0.8	0.5	2358	1999	255700	214908	0.5	1280757	3449467	3012847	436620
S-250701-00109	0.3	21366	2123166	1839796	1597624	242172	0.9	2.1	1.5	248035	39581	0.8	208454	0.8	0.4	1084	908	162379	139782	0.5	582197	2251294	1946768	304526
S-250701-00110	0.4	25639	2999489	2157563	1847433	310130	0.9	2.1	1.3	290325	47928	0.8	242397	0.8	0.4	1474	1234	195473	168219	0.5	821044	2644835	2259283	385552
S-250701-00111	0.6	31338	4418782	2573922	2320452	253470	0.9	2.1	1.4	367886	56867	0.8	311019	0.8	0.4	2224	1967	266557	228983	0.5	1214772	3210589	2862421	348168
S-250701-00112	0.4	23908	2801484	2047785	1701112	346673	0.8	2.0	1.1	271538	46250	0.8	225288	0.8	0.4	1365	1136	181239	155450	0.5	741675	2501927	2082986	418941
S-250701-00113	0.4	22881	2437109	1930303	1678972	251331	0.9	2.1	1.6	263580	43084	0.8	220496	0.8	0.4	1139	912	173891	149297	0.5	655435	2368913	2049677	319236
S-250701-00114	0.6	26088	4782934	2552832	2201908	350924	0.9	2.1	1.5	365826	65169	0.8	300657	0.8	0.4	2263	1912	256091	218482	0.6	1173145	3177012	2722959	454053
S-250701-00115	0.4	24340	2981120	2136033	1836324	299709	0.9	2.0	1.4	298095	50990	0.8	247105	0.8	0.4	1556	1313	206781	177188	0.5	812654	2642465	2261930	380535
S-250701-00116	0.4	22713	2170709	1849825	1626419	223406	0.9	2.1	1.7	251207	39931	0.8	211276	0.8	0.4	1063	865	164841	142381	0.5	604608	2266936	1980941	285995
S-250701-00117	0.3	21758	1820396	1674146	1437143	237003	0.9	2.1	1.4	224821	37572	0.8	187249	0.8	0.4	1046	832	150994	129980	0.5	503809	2051007	1755204	295803
S-250701-00118	0.4	24043	2308766	1923459	1662081	261378	0.9	2.1	1.5	264078	44448	0.8	219630	0.8	0.4	1260	1061	180047	154545	0.5	662038	2368844	2037317	331527
S-250701-00119	0.3	20468	1259404	1455557	1277056	178501	0.9	2.1	1.5	201228	31728	0.8	169500	0.8	0.4	747	615	136264	117580	0.5	394476	1793796	1564751	229045
S-250701-00120	0.4	23943	2478965	2013387	1769472	243915	0.9	2.1	1.4	276305	43294	0.8	233011	0.8	0.4	1306	1089	188665	162292	0.5	722691	2479663	2165864	313799
S-250701-00790	0.3	21619	1976109	1760138	1529104	231034	0.9	2.1	1.5	237298	37613	0.8	199685	0.8	0.4	1064	877	153993	132900	0.5	548178	2152493	1862566	289927
S-250702-00132	0.3	22114	1748999	1759484	1551429	208055	0.9	2.1	1.6	233852	38337	0.8	195515	0.8	0.4	973	815	145600	123599	0.5	511503	2139909	1871358	268551
S-250702-00140	0.3	23274	2027961	1935381	1705182	230199	0.9	2.1	1.4	247365	40218	0.8	207147	0.8	0.5	1122	940	150732	127337	0.5	587905	2334600	2040606	293994
S-250702-01152	0.4	24465	2876934	2075420	1800296	275124	0.9	2.1	1.5	288886	48162	0.8	240724	0.8	0.4	1456	1225	198078	170394	0.5	771731	2563840	2212639	351201
S-250702-01169	0.3	23878	1921793	1764574	1545551	219023	0.9	2.1	1.5	240696	38630	0.8	202066	0.8	0.4	1065	895	165206	142041	0.5	563093	2171541	1890553	280988
S-250702-01252	0.4	22091	2489295	2000018	1741667	258351	0.9	2.1	1.6	270716	43818	0.8	226898	0.8	0.4	1340	1093	178294	152725	0.5	701642	2450368	2122383	327985
S-250702-01259	0.4	26696	2932764	2286498	2042518	243980	0.9	2.1	1.4	305988	48230	0.8	257758	0.8	0.5	1606	1360	197417	167490	0.5	861575	2791509	2469126	322383
S-250702-01266	0.3	22017	1921241	1770439	1566144	204295	0.9	2.1	1.6	247020	38813	0.8	208207	0.8	0.4	959	798	166618	143316	0.5	564738	2185036	1918465	266571
S-250702-01290	0.5	24263	3080069	2163349	1866241	297108	0.9	2.1	1.5	301244	49923	0.8	251321	0.8	0.4	1555	1261	207277	177982	0.5	835756	2673425	2296805	376620
S-250702-01308	0.4	22154	1942478	1792240	1578145	214095	0.9	2.1	1.6	249591	40741	0.8	208850	0.8	0.4	1070	860	169355	145398	0.5	576950	2212256	1933253	279003
S-250707-01209	0.4	22917	2750916	2063807	1787136	276671	0.9	2.1	1.5	279612	48276	0.8	231336	0.8	0.4	1333	1110	178120	151213	0.5	712615	2522872	2170795	352077
S-250707-01210	0.3	22306	1972144	1793511	1566644	226867	0.9	2.1	1.6	235186	36994	0.8	198192	0.8	0.4	1009	808	150857	130338	0.5	563376	2180563	1895982	284581
S-250707-01211	0.3	19205	1328317	1445735	1266166	179569	0.9	2.1	1.6	196072	31553	0.8	164519	0.8	0.4	708	575	131022	113178	0.5	382457	1773537	1544438	229099
S-250707-01212	0.4	21885	2604946	2001920	1728398	273522	0.9	2.1	1.5	274454	45282	0.8	229172	0.8	0.4	1305	1062	182514	156981	0.5	702209	2460193	2115613	344580
S-250707-01213	0.3	20898	1793400	1782749	1537113	245636	0.9	2.1	1.3	232815	40018	0.8	192797	0.8	0.4	1029	831	144494	121976	0.5	501418	2161087	1852717	308370
S-250707-01214	0.4	24048	2669080	2064091	1807242	256849	0.9	2.1	1.5	279235	43229	0.8	236006	0.8	0.4	1309	1086	183670	158161	0.5	754100	2528305	2202495	325810
S-250707-01215	0.5	27679	3416814	2409022	2101189	307833	0.9	2.1	1.6	326131	57384	0.8	268747	0.8	0.4	1878	1570	214145	181169	0.5	919616	2951176	2552675	398501
S-250707-01216	0.4	21359	2123750	1836317	1592204	244113	0.9	2.1	1.4	245868	38989	0.8	206879	0.8	0.4	1053	868	159829	138052	0.5	590160	2243067	1938003	305064
S-250707-01217	0.5	29827	3857352	2393016	2147030	245986	0.9	2.1	1.5	346974	55448	0.8	291526	0.8	0.4	1934	1709	248838	213010	0.5	1050595	2990762	2653275	337487
S-250707-01218	0.4	22868	2763433	2068749	1807737	261012	0.9	2.1	1.5	274268	42984	0.8	231284	0.8	0.4	1285	1061	177463	152749	0.5	746828	2521765	2192831	328934
S-250707-01219	0.4	20815	2222781	1845137	1611903	233234	0.9	2.1	1.8	242597	39008	0.8	203589	0.8	0.4	1092	898	150672	130152	0.5	598478	2239498	1946542	292956
S-250707-01220	0.3	22190	1706741	1702280	1493810	208470	0.9	2.1	1.6	224730	34889	0.8	189841	0.8	0.4	949	774	142498	122877	0.5	504391	2070457	1807302	263155
S-250707-01221	0.5	25764	3787859	2360744	2058395	302349	0.9	2.1	1.6	333303	56896	0.8	276407	0.8	0.4	1906	1616	232107	198550	0.5	997693	2928060	2534968	393092
S-250707-01222	0.4	24514	2588467	2060376	1840909	219467	0.9	2.1	1.6	284068	42887	0.8	241181	0.8	0.4	1303	1089	187640	161435	0.5	748940	2533387	2244614	288773
S-250707-01223	0.4	22471	2760640	2040845	1764942	275903	0.9	2.0	1.5	281418	45958	0.8	235460	0.8	0.4	1376	1117	185012	159377	0.5	731062	2508651	2160896	347755
S-250707-01224	0.4	23298	1890951	1784745	1590455	194290	0.9	2.1	1.6	243898	36944	0.8	206954	0.8	0.4	1070	884	161741	139478	0.5	570170	2191454	1937771	253683
S-250707-01225	0.4	24142	2284101	1981763	1778904	202859	0.9	2.1	1.6	268240	39757	0.9	228483	0.8	0.4	1240	1048	173938	149949	0.5	699226	2425181	2158384	266797
S-250707-01226	0.4	24547	3060632	2194975	1882582	312393	0.9	2.1	1.5	287006	53612	0.8	233394	0.8	0.4	1558	1304	181560	152451	0.5	803575	2665099	2269731	395368
S-250707-01227	0.4	21915	2015409	1834938	1617400	217538	0.9	2.1	1.4	247568	43015	0.8	204553	0.8	0.4	1104	904	161562	135694	0.5	586016	2245172	1958551	286621
S-250707-01228	0.5	24808	3125303	2215700	1962895	252805	0.9	2.1	1.6	307253	49369	0.8	257884	0.8	0.4	1596	1359	205337	175951	0.5	886640	2729886	2398089	331797
S-250707-01229	0.4	23048	2051041	1825387	1612499	212888	0.9	2.1	1.7	252580	40022	0.8	212558	0.8	0.4	1106	871	168806	145359	0.5	593913	2247879	1971287	276592
S-250707-01230	0.4	23049	2248406	1917146	1689663	227483	0.9	2.1	1.7	259453	40856	0.8	218597	0.8	0.4	1149	960	169207	145762	0.5	646234	2346955	2054982	291973
S-250707-01235	0.3	19705	1585655	1607021	1417048	189973	0.9	2.1	1.8	208260	31908	0.8	176352	0.8	0.4	832	672	129004	111558	0.5	454026	1945117	1705630	239487
S-250709-00653	0.3	20029	2254023	1868020	1635944	232076	0.9	2.1	1.8	228454	37810	0.8	190644	0.8	0.4	989	788	126603	107146	0.5	567081	2224066	1934522	289544
S-250711-00769	0.4	23890	2516653	1990042	1737411	252631	0.9	2.1	1.7	267371	43117	0.8	224254	0.8	0.4	1270	1083	179867	154340	0.5	698152	2438550	2117088	321462
S-250711-00770	0.3	21319	1930832	1752019	1526889	225130	0.9	2.1	1.5	234668	37267	0.8	197401	0.8	0.4	1075	874	151072	130492	0.5	539612	2138834	1855656	283178
S-250711-00777	0.4	23762	2165835	1949265	1718858	230407	0.9	2.1	1.5	254052	40722	0.8	213330	0.8	0.5	1224	993	157208	133852	0.5	619860	2361749	2067033	294716
S-250711-00784	0.3	22619	1885533	1764704	1560340	204364	0.9	2.1	1.7	245222	38463	0.8	206759	0.8	0.4	1054	882	169637	146508	0.5	563860	2180617	1914489	266128
S-250711-00792	0.4	21062	2300383	1899766	1657216	242550	0.9	2.1	1.6	259514	43418	0.8	216096	0.8	0.4	1148	963	170940	146780	0.5	632005	2331368	2021055	310313
S-250711-00800	0.3	22180	1692427	1670850	1472984	197866	0.9	2.1	1.7	225565	35141	0.8	190424	0.8	0.4	932	781	148852	128703	0.5	492022	2046199	1792892	253307
S-250711-00814	0.4	21903	2333790	1905109	1655698	249411	0.9	2.1	1.7	272639	47867	0.8	224772	0.8	0.4	1266	1053	186198	159569	0.5	665930	2365212	2041092	324120
S-250711-00830	0.4	22728	2790998	2024783	1771968	252815	0.9	2.1	1.6	277634	44837	0.8	232797	0.8	0.4	1280	1000	182118	156808	0.5	716170	2485815	2162573	323242
S-250711-00837	0.4	22582	2896458	2094535	1833125	261410	0.9	2.1	1.7	290548	47863	0.8	242685	0.8	0.4	1450	1167	193256	166093	0.5	773845	2579789	2243070	336719
S-250711-00844	0.4	24660	2794593	2097708	1870606	227102	0.9	2.1	1.6	289282	43822	0.8	245460	0.8	0.4	1394	1132	194068	167246	0.5	795306	2582452	2284444	298008
S-250714-00495	0.3	20097	1470551	1639348	1454013	185335	0.9	2.1	1.7	220599	33170	0.8	187429	0.8	0.4	854	698	142744	123558	0.5	441833	2003545	1765698	237847
S-250714-00829	0.5	25514	2918704	2184610	1935000	249610	0.9	2.1	1.7	303377	47982	0.8	255395	0.8	0.4	1534	1267	206375	177030	0.5	854510	2695896	2368692	327204
S-250714-00830	0.3	19258	1388163	1536278	1357034	179244	0.9	2.1	1.6	209269	32814	0.8	176455	0.8	0.4	833	691	135432	116433	0.5	419564	1881812	1650613	231199
S-250714-00831	0.3	20799	1577071	1670614	1486622	183992	0.9	2.1	1.7	221288	35341	0.8	185947	0.8	0.4	843	707	139599	118916	0.5	473250	2032344	1792192	240152
S-250714-00832	0.3	23012	2163482	1986029	1726189	259840	0.9	2.1	1.3	256178	42026	0.8	214152	0.8	0.5	1175	956	158278	133850	0.5	623367	2401660	2075147	326513
S-250714-00833	0.3	20682	1465631	1579419	1392413	187006	0.9	2.1	1.6	205963	31864	0.8	174099	0.8	0.4	792	652	128687	110985	0.5	436778	1914861	1678149	236712
S-250714-00834	0.3	21622	1932538	1748690	1532098	216592	0.9	2.1	1.6	234182	36914	0.8	197268	0.8	0.4	986	778	149788	129400	0.5	530321	2133646	1859544	274102
S-250714-00835	0.3	20873	1921298	1742557	1533414	209143	0.9	2.1	1.8	223563	33950	0.8	189613	0.8	0.4	980	789	140295	121123	0.5	517994	2107395	1844939	262456
S-250714-00836	0.4	23025	2169932	1849351	1622615	226736	0.9	2.1	1.7	251513	39675	0.8	211838	0.8	0.4	1145	968	167351	144881	0.5	608327	2269360	1980302	289058
S-250714-00837	0.4	23892	2984866	2139761	1875056	264705	0.9	2.1	1.6	295539	48016	0.8	247523	0.8	0.4	1488	1246	198207	170615	0.5	817711	2634995	2294440	340555
S-250714-00838	0.3	20430	1671916	1656706	1424593	232113	0.9	2.1	1.2	209589	31550	0.8	178039	0.8	0.4	807	666	129476	112022	0.5	474914	1996578	1715320	281258
S-250806-00453	0.4	23594	2986206	2034874	1719880	314994	0.8	2.1	1.3	269150	48334	0.8	220816	0.8	0.4	1216	1040	166853	142738	0.5	719115	2472093	2084474	387619
S-250806-00458	0.5	24474	4048849	2314267	1939499	374768	0.8	2.1	1.3	289558	49551	0.8	240007	0.8	0.4	1491	1244	171858	148073	0.6	917571	2777174	2328823	448351
S-250808-00180	0.4	22679	2491162	1891423	1601993	289430	0.8	2.1	1.5	252400	45240	0.8	207160	0.8	0.4	1166	979	157140	133959	0.5	615353	2302129	1944091	358038
S-250808-01397	0.3	21862	2216817	1788430	1481602	306828	0.8	2.0	1.0	229765	40151	0.8	189614	0.8	0.4	1037	853	142758	122152	0.5	556902	2161990	1794221	367769
S-250808-01457	0.4	23710	2709296	1974081	1669414	304667	0.8	2.1	1.4	261194	45877	0.8	215317	0.8	0.4	1211	1016	164669	140305	0.5	678649	2401155	2026052	375103
S-250808-01486	0.6	28029	5575385	2682677	2237830	444847	0.8	2.1	1.4	364668	67967	0.8	296701	0.8	0.4	2233	1953	242782	206700	0.6	1210304	3292360	2743184	549176
S-250814-00600	0.7	27576	7617549	3014492	2478477	536015	0.8	2.0	1.4	382296	68750	0.8	313546	0.8	0.4	2430	2084	234600	201477	0.6	1486170	3633818	2995584	638234
S-250814-00606	0.4	24368	3023281	2187773	1891092	296681	0.9	2.1	1.5	279212	49113	0.8	230099	0.8	0.4	1376	1156	166479	139897	0.5	742922	2634840	2262244	372596
S-250814-00618	0.4	25894	3299898	2265567	1940875	324692	0.9	2.1	1.4	295681	54349	0.8	241332	0.8	0.4	1539	1295	181317	152337	0.5	803201	2744104	2335839	408265
S-250814-00629	0.4	22551	3043095	2041634	1763922	277712	0.9	2.1	1.8	251213	41005	0.8	210208	0.8	0.4	1184	987	143169	122855	0.5	710110	2437200	2097972	339228
S-250814-00732	0.5	26540	4218376	2332558	1936141	396417	0.8	2.0	1.4	310181	57572	0.8	252609	0.8	0.4	1630	1411	199446	170362	0.6	951291	2843815	2360523	483292
S-250819-00049	0.3	21264	1896453	1755305	1529667	225638	0.9	2.1	1.6	225832	44215	0.8	181617	0.8	0.3	908	767	125968	106513	0.5	496524	2108013	1818564	289449
S-250820-00433	0.5	27958	4359939	2523100	2134496	388604	0.8	2.1	1.2	329202	61257	0.8	267945	0.8	0.4	1855	1602	205673	172757	0.5	1028642	3059830	2576800	483030
S-250820-00481	0.5	24822	3633588	2127506	1820005	307501	0.9	2.1	1.7	283390	49887	0.8	233503	0.8	0.4	1388	1197	180124	153559	0.6	847814	2592408	2208264	384144
S-250820-00482	0.4	24399	2893919	2005446	1709748	295698	0.9	2.1	1.6	272609	49180	0.8	223429	0.8	0.4	1193	1014	173500	148017	0.5	707689	2452748	2082208	370540
S-250820-00483	0.4	24616	2943071	2021130	1717609	303521	0.8	2.1	1.7	271860	50027	0.8	221833	0.8	0.4	1323	1110	173532	148165	0.5	711383	2467845	2088717	379128
S-250820-00484	0.5	24076	3640951	2177809	1864066	313743	0.9	2.1	1.8	268116	44998	0.8	223118	0.8	0.4	1382	1154	152270	129976	0.5	814723	2599577	2218314	381263
S-250820-00485	0.4	24084	3086424	2084763	1791923	292840	0.9	2.1	1.7	275417	48007	0.8	227410	0.8	0.4	1263	1055	169397	144970	0.5	743389	2530840	2165358	365482
S-250820-00486	0.4	23392	2801776	2006778	1693844	312934	0.8	2.0	1.4	265195	49895	0.8	215300	0.8	0.3	1218	1025	159016	135970	0.5	685611	2432207	2046139	386068
S-250822-00209	0.5	25496	3674217	2234141	1906468	327673	0.9	2.1	1.8	299997	53352	0.8	246645	0.8	0.4	1596	1369	194441	166017	0.5	870262	2730175	2320499	409676
S-250822-00210	0.3	21644	2257133	1791401	1539386	252015	0.9	2.1	1.7	235273	40222	0.8	195051	0.8	0.4	972	818	142261	121962	0.5	550361	2169907	1857217	312690
S-250822-00211	0.4	22893	2481174	1896050	1628444	267606	0.9	2.1	1.7	253055	44675	0.8	208380	0.8	0.4	1073	887	156734	133842	0.5	622084	2306912	1971553	335359
S-250822-00212	0.4	24987	3390816	2177433	1856711	320722	0.9	2.1	1.8	290723	51468	0.8	239255	0.8	0.4	1500	1243	185183	157873	0.5	816329	2654839	2255082	399757
S-250822-00213	0.5	25147	3835653	2261429	1928564	332865	0.9	2.1	1.8	301070	53547	0.8	247523	0.8	0.4	1502	1260	186935	159769	0.5	885016	2750936	2337116	413820
S-250822-00214	0.4	24150	3271090	2115099	1817891	297208	0.9	2.1	1.8	282050	48938	0.8	233112	0.8	0.4	1338	1136	178919	152975	0.5	782332	2577406	2205114	372292
S-250822-00215	0.4	22784	2582357	1924779	1650165	274614	0.9	2.1	1.6	254397	43846	0.8	210551	0.8	0.4	1225	1005	155682	133182	0.5	637906	2336083	1994903	341180
S-250822-00216	0.3	21845	2214761	1818337	1571293	247044	0.9	2.1	1.8	240741	41440	0.8	199301	0.8	0.4	1065	852	150255	128520	0.5	572564	2210398	1899966	310432
S-250822-00217	0.3	19918	1760193	1591018	1375964	215054	0.9	2.1	1.7	197322	32737	0.8	164585	0.8	0.4	795	644	107668	92320	0.5	428662	1896803	1633513	263290
S-250822-00218	0.4	21905	2333753	1859989	1596094	263895	0.9	2.1	1.4	244758	41564	0.8	203194	0.8	0.4	1092	918	153097	131351	0.5	596591	2258936	1931557	327379
S-250822-00219	0.4	22933	2707104	1957619	1679980	277639	0.9	2.1	1.7	258358	45112	0.8	213246	0.8	0.4	1149	961	159458	136540	0.5	659245	2376584	2030727	345857
S-250822-00220	0.4	24403	3015148	2081235	1763093	318142	0.8	2.0	1.4	279225	49023	0.8	230202	0.8	0.4	1280	1092	177284	151657	0.5	744444	2539024	2146044	392980
S-250822-00221	0.3	21958	2195208	1785124	1536686	248438	0.9	2.1	1.8	238000	42043	0.8	195957	0.8	0.4	1016	852	144734	123993	0.5	551786	2168874	1857488	311386
S-250822-00222	0.4	21780	2364073	1847592	1569888	277704	0.8	2.1	1.5	237522	40484	0.8	197038	0.8	0.4	1053	872	142011	122094	0.5	582765	2228178	1889892	338286
S-250822-00223	0.4	23178	3034198	2073611	1790407	283204	0.9	2.1	1.7	275722	47056	0.8	228666	0.8	0.4	1232	1035	171374	147128	0.5	740888	2521939	2167236	354703
S-250822-00224	0.4	24241	3167694	2101160	1801109	300051	0.9	2.1	1.7	273756	46771	0.8	226985	0.8	0.4	1312	1083	167305	143642	0.5	752016	2543533	2172819	370714
S-250822-00225	0.3	22514	2209215	1851545	1617529	234016	0.9	2.1	1.6	234788	39247	0.8	195541	0.8	0.4	980	815	136670	116287	0.5	569606	2223983	1930172	293811
S-250822-00226	0.4	21963	2520108	1882292	1622323	259969	0.9	2.1	1.6	239378	39056	0.8	200322	0.8	0.4	1046	843	141286	121292	0.5	606449	2264002	1944780	319222
S-250822-00227	0.4	23005	3102252	2089203	1708190	381013	0.8	2.1	0.9	247127	43997	0.8	203130	0.8	0.3	1184	992	134710	115624	0.5	729819	2472224	2027936	444288
S-250822-00228	0.5	27176	4609078	2428460	2052947	375513	0.8	2.1	1.8	324825	59272	0.8	265553	0.8	0.4	1805	1574	208000	177346	0.6	1012543	2963090	2497420	465670
S-250822-00229	0.5	26695	4113833	2331510	2006437	325073	0.9	2.1	1.9	317905	56716	0.8	261189	0.8	0.4	1550	1303	209049	178204	0.5	962019	2860014	2447133	412881
S-250822-00230	0.2	17911	1242512	1372506	1178746	193760	0.9	2.1	1.5	180653	31692	0.8	148961	0.8	0.4	651	497	109628	93721	0.5	333025	1663438	1421925	241513
S-250822-00231	0.4	22567	2545965	1963401	1701987	261414	0.9	2.1	1.8	255550	42579	0.8	212971	0.8	0.4	1029	854	150304	128972	0.5	618119	2370284	2044784	325500
S-250822-00232	0.4	24109	2934099	2031057	1745220	285837	0.9	2.1	1.5	269852	46107	0.8	223745	0.8	0.4	1247	1040	166803	143439	0.5	717907	2468959	2113444	355515
S-250822-00233	0.4	21309	2283681	1841421	1607800	233621	0.9	2.1	1.7	233741	38958	0.8	194783	0.8	0.4	1026	823	132581	113136	0.5	575775	2208769	1916542	292227
S-250822-00492	0.4	23419	3035223	2057246	1729855	327391	0.8	2.1	1.3	252451	42774	0.8	209677	0.8	0.4	1159	974	144619	123884	0.5	714732	2455475	2064390	391085
S-250822-00494	0.4	22702	2636658	1930396	1667644	262752	0.9	2.1	1.8	256693	44669	0.8	212024	0.8	0.4	1111	932	157154	134529	0.5	646356	2345354	2015129	330225
S-250822-00495	0.4	25332	3180820	2150402	1831466	318936	0.9	2.1	1.9	293920	53704	0.8	240216	0.8	0.4	1423	1224	189520	161381	0.6	755492	2635265	2234287	400978
S-250822-00496	0.3	22117	1989790	1795767	1545522	250245	0.9	2.1	1.5	228531	45695	0.8	182836	0.8	0.3	974	821	127751	107029	0.5	517871	2153023	1836208	316815
S-250822-00497	0.5	25045	3675203	2354973	2043267	311706	0.9	2.1	1.7	291726	49437	0.8	242289	0.8	0.4	1496	1269	164304	138807	0.5	879033	2812499	2425632	386867
S-250822-00498	0.4	23273	2725420	1983813	1708661	275152	0.9	2.1	1.7	254229	43037	0.8	211192	0.8	0.4	1199	1004	152042	130294	0.5	673479	2391283	2051151	340132
S-250822-00499	0.4	22829	2758432	1977559	1706732	270827	0.9	2.1	1.8	259341	44457	0.8	214884	0.8	0.4	1171	941	158166	135364	0.5	674310	2396237	2057921	338316
S-250822-00500	0.4	22573	2574257	1911419	1640911	270508	0.9	2.1	1.8	251822	43472	0.8	208350	0.8	0.4	1082	900	155730	133536	0.5	639412	2320053	1983697	336356
S-250822-00501	0.4	22646	2409483	1842456	1588536	253920	0.9	2.1	1.9	248241	43798	0.8	204443	0.8	0.4	1104	928	156147	132999	0.5	596177	2247948	1926906	321042
S-250822-00502	0.4	21975	2621585	1924937	1641081	283856	0.9	2.1	1.3	248959	42171	0.8	206788	0.8	0.4	1063	905	150751	129416	0.5	638674	2325710	1978190	347520
S-250822-00503	0.3	21195	2172505	1776175	1542386	233789	0.9	2.1	1.8	234799	39012	0.8	195787	0.8	0.4	937	773	144507	124299	0.5	549678	2156418	1863245	293173
S-250822-00504	0.3	20879	2048111	1739904	1510392	229512	0.9	2.1	1.7	223755	38794	0.8	184961	0.8	0.4	893	736	132147	113020	0.5	522886	2096699	1809109	287590
S-250822-00505	0.4	24918	3049139	2049289	1741873	307416	0.8	2.1	1.7	279754	52254	0.8	227500	0.8	0.4	1287	1099	179532	152997	0.5	734185	2509862	2123469	386393
S-250822-00506	0.4	23395	2592956	1902731	1628991	273740	0.9	2.1	1.7	255704	47421	0.8	208283	0.8	0.4	1141	952	159207	135475	0.5	632480	2318783	1973701	345082
S-250822-00507	0.5	24204	3459989	2151609	1847960	303649	0.9	2.1	1.7	288138	51248	0.8	236890	0.8	0.4	1420	1198	183027	156090	0.5	827902	2624194	2242138	382056
S-250822-00508	0.3	20531	2160123	1744281	1519924	224357	0.9	2.1	1.7	218542	35933	0.8	182609	0.8	0.4	954	767	122586	105164	0.5	515401	2086363	1808464	277899
S-250822-00872	0.3	20645	2205796	1803354	1561900	241454	0.9	2.1	1.7	222380	36543	0.8	185837	0.8	0.4	925	780	123958	106402	0.5	551381	2150617	1854919	295698
S-250825-00001	0.4	23621	3322952	2153564	1850284	303280	0.9	2.1	1.7	267615	44610	0.8	223005	0.8	0.4	1318	1111	154859	132289	0.5	786303	2577356	2206689	370667
S-250827-00660	0.4	22961	2484939	1864519	1586678	277841	0.9	2.1	1.6	253783	47660	0.8	206123	0.8	0.4	1102	897	162559	138359	0.5	616847	2281963	1932057	349906
S-250827-00667	0.4	22046	2483323	1947505	1687619	259886	0.9	2.1	1.6	253628	44926	0.8	208702	0.8	0.4	1161	959	151630	128259	0.5	625428	2353924	2025539	328385
S-250827-00674	0.4	23177	2945557	2133867	1837379	296488	0.9	2.1	1.5	259905	45977	0.8	213928	0.8	0.4	1195	986	140602	118114	0.5	707079	2535569	2170407	365162
S-250827-00681	0.3	21472	1967396	1746243	1516773	229470	0.9	2.1	1.6	235923	38953	0.8	196970	0.8	0.4	927	764	156869	135362	0.5	543608	2139962	1849869	290093
S-250827-00688	0.4	23880	2847028	1990005	1707886	282119	0.9	2.1	1.8	267368	47923	0.8	219445	0.8	0.4	1297	1083	172591	146788	0.5	693665	2431261	2075202	356059
S-250827-00695	0.3	18800	1517473	1531278	1328373	202905	0.9	2.0	1.5	219084	41409	0.8	177675	0.8	0.6	878	694	134461	114915	0.5	429149	1885701	1621657	264044
S-250827-00702	0.4	23834	2906552	2102956	1815207	287749	0.9	2.1	1.6	277581	50148	0.8	227433	0.8	0.4	1355	1156	168895	143055	0.5	726461	2550787	2186851	363936
S-250827-00709	0.4	22474	2804326	2007395	1717344	290051	0.9	2.1	1.7	258594	51339	0.8	207255	0.8	0.3	1119	949	141666	121851	0.5	683942	2408774	2047399	361375
S-250827-00716	0.4	23911	3381761	2115352	1816224	299128	0.9	2.1	1.8	268817	49164	0.8	219653	0.8	0.3	1211	1022	152867	130919	0.5	779683	2538247	2167818	370429
S-250827-00723	0.4	23090	2424097	1859773	1604912	254861	0.9	2.1	1.8	249792	46324	0.8	203468	0.8	0.4	1085	931	153380	130274	0.5	599954	2264030	1939585	324445
S-250827-00730	0.4	23005	3027121	2044393	1761656	282737	0.9	2.1	1.8	271042	47410	0.8	223632	0.8	0.4	1289	1047	165334	141804	0.5	726494	2482058	2128139	353919
S-250827-00737	0.3	19647	1708161	1581122	1367527	213595	0.9	2.1	1.7	207975	35336	0.8	172639	0.8	0.4	780	639	126931	109030	0.5	437323	1916808	1649835	266973
S-250827-00744	0.5	23769	3297866	2204900	1892650	312250	0.9	2.1	1.5	304521	51703	0.8	252818	0.8	0.4	1595	1329	207791	177303	0.5	855553	2718807	2324100	394707
S-250827-00751	0.4	23335	3304984	2122093	1820090	302003	0.9	2.1	1.7	275260	47934	0.8	227326	0.8	0.4	1208	986	164797	141413	0.5	771670	2563358	2189815	373543
S-250827-00758	0.3	20768	1984387	1699192	1470916	228276	0.9	2.1	1.7	227244	40443	0.8	186801	0.8	0.4	924	783	140196	120023	0.5	505557	2067556	1778523	289033
S-250827-00765	0.5	24639	3433227	2204278	1900817	303461	0.9	2.1	1.7	302821	51086	0.8	251735	0.8	0.4	1625	1368	200280	172429	0.5	863681	2709004	2326349	382655
S-250827-00772	0.4	23387	3054106	2085869	1806768	279101	0.9	2.0	1.7	297610	51393	0.8	246217	0.8	0.4	1593	1343	204804	175585	0.5	793434	2589876	2229913	359963
S-250827-00779	0.4	19703	2180317	1792399	1558990	233409	0.9	2.1	1.6	244439	41293	0.8	203146	0.8	0.4	1086	879	157979	134945	0.5	571383	2195903	1897960	297943
S-250827-01007	0.4	22078	2938664	2017819	1701514	316305	0.8	2.1	1.2	242517	39769	0.8	202748	0.8	0.4	1110	936	136182	116648	0.5	687420	2397628	2021846	375782
S-250827-01012	0.3	22014	2139305	1766555	1532353	234202	0.9	2.1	1.8	239487	42517	0.8	196970	0.8	0.4	1070	879	152682	130412	0.5	547217	2159794	1860614	299180
S-250827-01201	0.4	22460	3029034	2018113	1698651	319462	0.8	2.1	1.3	230601	37923	0.8	192678	0.8	0.4	1104	930	124711	106106	0.5	689711	2374529	1998365	376164
S-250827-01310	0.3	19191	1635116	1586594	1363870	222724	0.9	2.1	1.5	186001	31055	0.8	154946	0.8	0.4	791	657	98028	84090	0.5	401174	1871414	1603563	267851
S-250827-01323	0.3	23572	2423206	1919663	1654520	265143	0.9	2.1	1.8	246558	41927	0.8	204631	0.8	0.4	1093	937	145471	124532	0.5	584109	2312785	1984620	328165
S-250827-01330	0.4	24147	3304141	2139114	1855182	283932	0.9	2.1	1.7	284114	47268	0.8	236846	0.8	0.4	1307	1123	180101	154753	0.5	792526	2604636	2247904	356732
S-250827-01337	0.4	23374	2666681	1981707	1720916	260791	0.9	2.1	1.8	261505	45991	0.8	215514	0.8	0.4	1230	1045	160842	136357	0.5	659129	2405284	2073832	331452
S-250827-01345	0.5	24699	3453980	2220201	1921653	298548	0.9	2.1	1.6	307042	50530	0.8	256512	0.8	0.4	1556	1316	206090	177500	0.5	886821	2734889	2356981	377908
S-250827-01352	0.5	24007	3719673	2221520	1894126	327394	0.9	2.1	1.7	274575	47077	0.8	227498	0.8	0.4	1339	1111	158175	134948	0.5	841629	2655609	2257683	397926
S-250827-01359	0.3	20752	1891325	1654893	1420105	234788	0.9	2.1	1.5	211636	36854	0.8	174782	0.8	0.4	896	728	124204	106136	0.5	468461	1991629	1701751	289878
S-250829-00121	0.3	22630	2191069	1779851	1494938	284913	0.8	2.0	1.2	235214	43758	0.8	191456	0.8	0.3	1067	906	143495	122298	0.5	547844	2159627	1809598	350029
S-250829-00149	0.4	23800	2869199	2020960	1729144	291816	0.9	2.1	1.5	263519	47142	0.8	216377	0.8	0.4	1236	1037	158615	134790	0.5	707290	2444330	2081348	362982
S-250829-00274	0.4	21937	2559491	1832440	1553688	278752	0.8	2.1	1.6	207090	33911	0.8	173179	0.8	0.4	991	806	109955	93663	0.5	583382	2150476	1821336	329140
S-250829-00275	0.3	21482	2205707	1794261	1543893	250368	0.9	2.1	1.5	239058	41414	0.8	197644	0.8	0.4	992	823	147496	126442	0.5	558564	2181807	1868802	313005
S-250829-00276	0.4	21295	2321016	1826327	1577981	248346	0.9	2.1	1.6	229706	38689	0.8	191017	0.8	0.4	987	801	133783	114703	0.5	575334	2190803	1884502	306301
S-250829-00277	0.4	21524	2324833	1807332	1536238	271094	0.9	2.1	1.3	222889	37092	0.8	185797	0.8	0.4	937	800	127445	109131	0.5	560998	2158603	1831966	326637
S-250829-00278	0.4	22110	2287908	1871025	1605816	265209	0.9	2.0	1.4	251989	41001	0.8	210988	0.8	0.4	1106	921	164663	142248	0.5	615592	2288783	1959973	328810
S-250829-00279	0.3	21947	2057513	1782602	1533504	249098	0.9	2.1	1.4	226553	36448	0.8	190105	0.8	0.4	1001	780	139873	120489	0.5	554944	2150029	1844878	305151
S-250829-00280	0.3	19693	2104380	1798933	1519939	278994	0.8	2.0	1.1	243028	40426	0.8	202602	0.8	0.4	1043	846	158477	135990	0.5	571197	2201481	1859377	342104
S-250902-00424	0.6	25492	5438371	2681813	2267628	414185	0.8	2.1	1.4	372363	67513	0.8	304850	0.8	0.4	2314	1985	255335	216746	0.5	1291548	3311825	2791209	520616
S-250908-00005	0.4	23224	2735544	2036480	1733691	302789	0.9	2.1	1.3	259100	41791	0.8	217309	0.8	0.4	1211	1002	160254	138008	0.5	707756	2457045	2090010	367035
S-250909-00166	0.4	23012	2979731	2094358	1810626	283732	0.9	2.1	1.6	288958	49412	0.8	239546	0.8	0.4	1439	1175	193616	166148	0.5	774675	2578371	2217495	360876
S-250909-00190	0.5	26406	3407071	2356714	2039738	316976	0.9	2.1	1.3	305330	51560	0.8	253770	0.8	0.4	1672	1388	190147	161179	0.5	894808	2853863	2456075	397788
S-250910-00496	0.4	23585	3212904	2132516	1827110	305406	0.9	2.1	1.6	271468	45259	0.8	226209	0.8	0.4	1253	1078	160932	138274	0.5	762570	2566169	2192671	373498
S-250911-00326	0.3	19908	1758864	1644947	1441282	203665	0.9	2.1	1.9	229298	38362	0.8	190936	0.8	0.4	1038	807	149298	128355	0.5	469657	2024581	1761380	263201
S-250911-00327	0.4	21590	2397880	1882059	1631993	250066	0.9	2.1	1.6	258775	44242	0.8	214533	0.8	0.4	1187	955	169760	145435	0.5	627803	2311781	1992916	318865
S-250911-00328	0.4	23882	2352715	1891814	1637133	254681	0.9	2.0	1.6	264277	44413	0.8	219864	0.8	0.4	1291	1069	177640	153213	0.5	642962	2335022	2011279	323743
S-250911-00329	0.4	23302	3071148	2110806	1836874	273932	0.9	2.1	1.6	277935	44728	0.8	233207	0.8	0.4	1423	1143	175185	150840	0.5	774200	2565349	2222064	343285
S-250911-00330	0.3	22344	2107801	1896419	1657995	238424	0.9	2.1	1.7	258441	46904	0.8	211537	0.8	0.4	1270	1051	164092	138225	0.5	571185	2320222	2008808	311414
S-250911-00331	0.4	23863	3094642	2148641	1851184	297457	0.9	2.1	1.6	288143	48530	0.8	239613	0.8	0.4	1464	1215	186054	159676	0.5	808641	2624302	2251688	372614
S-250911-00332	0.4	21510	2375087	1893750	1645296	248454	0.9	2.1	1.7	263691	45006	0.8	218685	0.8	0.4	1209	983	174610	149643	0.5	634682	2333260	2014607	318653
S-250911-00333	0.5	25440	3766387	2328725	2010017	318708	0.9	2.1	1.7	335930	59704	0.8	276226	0.8	0.4	1889	1628	237471	202760	0.5	983088	2904015	2490631	413384
S-250911-00334	0.3	21055	1904884	1736929	1507571	229358	0.9	2.1	1.5	222569	35570	0.8	186999	0.8	0.4	1011	837	136001	117221	0.5	528991	2096510	1812628	283882
S-250911-00335	0.3	20300	2263623	1818118	1570091	248027	0.9	2.1	1.8	227612	38524	0.8	189088	0.8	0.4	965	760	132845	113894	0.5	564101	2179540	1873833	305707
S-250911-00336	0.4	26005	2871957	2239413	1969910	269503	0.9	2.1	1.3	303765	51038	0.8	252727	0.8	0.4	1694	1395	200395	169257	0.5	791393	2745267	2393289	351978
S-250911-00337	0.4	24368	2504877	1993994	1741609	252385	0.9	2.1	1.7	269899	44656	0.8	225243	0.8	0.4	1334	1112	175751	151050	0.5	694530	2440978	2119014	321964
S-250911-00338	0.4	22892	2714453	2020494	1746232	274262	0.9	2.1	1.5	280387	47226	0.8	233161	0.8	0.4	1376	1133	188692	162237	0.5	724665	2490949	2142763	348186
S-250911-00339	0.4	23763	2853720	2119291	1892253	227038	0.9	2.1	1.6	293390	44711	0.8	248679	0.8	0.4	1375	1145	198596	171047	0.5	809214	2612652	2313124	299528
S-250911-00340	0.4	23038	2872575	2078466	1812188	266278	0.9	2.1	1.6	292436	48838	0.8	243598	0.8	0.4	1366	1138	199914	171859	0.5	765153	2572182	2228783	343399
S-250911-00341	0.5	27481	3617349	2502162	2214717	287445	0.9	2.1	1.6	341936	57813	0.8	284123	0.8	0.4	2040	1698	222801	188092	0.5	987611	3068939	2688630	380309
S-250911-00342	0.5	25360	3492413	2305713	2024115	281598	0.9	2.0	1.4	326089	52081	0.8	274008	0.8	0.4	1786	1514	224901	193925	0.5	943385	2858489	2493562	364927
S-250911-00343	0.5	25062	4314170	2446869	2134332	312537	0.9	2.1	1.7	344295	58727	0.8	285568	0.8	0.4	1989	1719	237010	202543	0.5	1075629	3030163	2624162	406001
S-250911-00344	0.6	26558	5299761	2702467	2335485	366982	0.9	2.1	1.6	366801	65651	0.8	301150	0.8	0.4	2252	1914	239972	204091	0.5	1274323	3311492	2842640	468852
S-250911-00345	0.4	21951	2634161	1993377	1727370	266007	0.9	2.1	1.7	273982	46692	0.8	227290	0.8	0.4	1277	1068	178061	153251	0.5	694924	2446697	2108979	337718
S-250911-00346	0.3	23666	1580816	1526418	1298267	228151	0.9	2.1	1.5	215997	41508	0.8	174489	0.8	0.4	979	815	149614	126689	0.5	448617	1893008	1600260	292748
S-250911-00347	0.4	24603	2992347	2250549	1978979	271570	0.9	2.1	1.7	306551	53842	0.8	252709	0.8	0.5	1575	1299	197569	166271	0.5	798174	2756244	2399258	356986
S-250911-01190	0.3	18189	1421306	1506420	1318303	188117	0.9	2.1	1.7	202791	33472	0.8	169319	0.8	0.4	779	622	125638	108299	0.5	399450	1835628	1596543	239085
S-250911-01197	0.3	20465	1946595	1789004	1559772	229232	0.9	2.0	1.7	251263	42359	0.8	208904	0.8	0.4	1068	886	164998	142020	0.5	529726	2206333	1911582	294751
S-250911-01205	0.3	20991	2052615	1774271	1551529	222742	0.9	2.1	1.8	249400	42228	0.8	207172	0.8	0.4	1082	867	165429	141842	0.5	559466	2190182	1901410	288772
S-250911-01242	0.3	20590	1871801	1695314	1482247	213067	0.9	2.1	1.6	233506	38624	0.8	194882	0.8	0.4	981	815	151881	130833	0.5	513796	2081682	1808777	272905
S-250911-01249	0.4	25595	2667319	2147565	1891949	255616	0.9	2.1	1.6	290114	49530	0.8	240584	0.8	0.4	1464	1193	186772	157928	0.5	742857	2625915	2291654	334261
S-250911-01282	0.4	22286	2930926	2061245	1783491	277754	0.9	2.0	1.6	290932	51278	0.8	239654	0.8	0.4	1437	1193	194047	166277	0.5	757300	2547661	2190615	357046
S-250911-01327	0.4	24625	2830871	2048536	1775961	272575	0.9	2.0	1.6	290457	49861	0.8	240596	0.8	0.4	1532	1281	199371	171295	0.5	752952	2539896	2189133	350763
S-250911-01376	0.4	24284	2928654	2111654	1837896	273758	0.9	2.1	1.5	296301	49166	0.8	247135	0.8	0.4	1483	1204	203111	173979	0.5	799202	2612549	2260214	352335
S-250911-01390	0.5	23796	3269908	2205121	1894163	310958	0.9	2.1	1.4	305521	52664	0.8	252857	0.8	0.4	1620	1335	209701	179459	0.5	860270	2721963	2327814	394149
S-250911-01404	0.4	22471	2577116	1949502	1691121	258381	0.9	2.1	1.7	260179	43215	0.8	216964	0.8	0.4	1222	978	162745	140213	0.5	660911	2373648	2049276	324372
S-250911-01421	0.4	21289	2269692	1862388	1616204	246184	0.9	2.1	1.7	259568	44782	0.8	214786	0.8	0.4	1126	944	173484	148474	0.5	609605	2296566	1980408	316158
S-250911-01428	0.4	23382	2564077	1971392	1714349	257043	0.9	2.1	1.7	269432	45061	0.8	224371	0.8	0.4	1279	1082	177687	153148	0.5	680818	2419790	2092950	326840
S-250911-01435	0.4	22520	3006793	2090157	1820874	269283	0.9	2.1	1.7	282766	46175	0.8	236591	0.8	0.4	1372	1139	180648	155983	0.5	761276	2554943	2214587	340356
S-250911-01442	0.4	23365	2232904	1881266	1653240	228026	0.9	2.1	1.6	257654	41388	0.8	216266	0.8	0.4	1186	991	174052	150753	0.5	625504	2314158	2021250	292908
S-250911-01450	0.4	22368	2692224	1948518	1677544	270974	0.9	2.0	1.8	273279	49567	0.8	223712	0.8	0.4	1312	1123	178488	152424	0.5	673271	2401597	2054803	346794
S-250911-01458	0.4	23088	2809186	2050657	1798177	252480	0.9	2.1	1.7	287129	47865	0.8	239264	0.8	0.4	1387	1147	191301	164466	0.5	743058	2530474	2203054	327420
S-250911-01547	0.3	29200	1547628	1700330	1561988	138342	0.9	2.0	1.2	257178	37920	0.9	219258	0.8	0.5	1085	917	191463	163843	0.5	543395	2150056	1946006	204050
S-250911-01554	0.5	24589	3202062	2183902	1905583	278319	0.9	2.1	1.7	301628	49029	0.8	252599	0.8	0.4	1497	1264	202567	174730	0.5	847485	2689594	2334176	355418
S-250911-01642	0.1	7404	150029	439755	393774	45981	0.9	2.1	1.6	61222	9532	0.8	51690	0.8	0.4	136	82	40008	34611	0.6	46851	541121	480157	60964
S-250911-01649	0.4	22533	2692971	2016097	1757417	258680	0.9	2.1	1.7	283161	47936	0.8	235225	0.8	0.4	1435	1159	191332	164168	0.5	718476	2492025	2157969	334056
S-250911-01656	0.5	27407	4270302	2656860	2327065	329795	0.9	2.1	1.6	363145	65329	0.8	297816	0.8	0.4	2297	1920	240381	201722	0.5	1115441	3262683	2828523	434160
S-250911-01663	0.4	23324	3166022	2158495	1878520	279975	0.9	2.1	1.6	298444	50219	0.8	248225	0.8	0.4	1411	1191	199883	171897	0.5	821403	2658233	2299833	358400
S-250911-01670	0.4	23061	3144875	2119622	1834173	285449	0.9	2.1	1.7	296690	51748	0.8	244942	0.8	0.4	1513	1242	201578	172347	0.5	802765	2619403	2252704	366699
S-250911-01678	0.4	23384	2383634	1941848	1689144	252704	0.9	2.1	1.6	263167	42956	0.8	220211	0.8	0.4	1202	989	174577	150713	0.5	666095	2380794	2061057	319737
S-250911-01685	0.5	23530	3877679	2331944	2021065	310879	0.9	2.1	1.8	326416	56455	0.8	269961	0.8	0.4	1784	1509	216271	185431	0.5	954267	2876415	2477966	398449
S-250911-01698	0.5	24366	3685809	2323783	2028783	295000	0.9	2.1	1.7	326838	56135	0.8	270703	0.8	0.4	1900	1567	224507	192225	0.5	963291	2877028	2493278	383750
S-250911-01781	0.4	22875	2887850	2048778	1767064	281714	0.9	2.1	1.5	283727	47761	0.8	235966	0.8	0.4	1390	1171	189938	163241	0.5	745286	2523833	2167442	356391
S-250911-01792	0.5	24052	3368549	2198583	1908951	289632	0.9	2.1	1.6	307386	52491	0.8	254895	0.8	0.4	1527	1290	210298	180074	0.5	858846	2717794	2345210	372584
S-250911-01801	0.5	23784	4360524	2421938	2079160	342778	0.9	2.1	1.7	318590	54393	0.8	264197	0.8	0.4	1795	1526	200927	172200	0.5	1015135	2943250	2517083	426167
S-250911-01808	0.4	23461	2908774	2072932	1800775	272157	0.9	2.1	1.6	279568	46395	0.8	233173	0.8	0.4	1362	1125	179740	154547	0.5	748515	2533602	2189620	343982
S-250911-01815	0.4	23126	2968623	2082436	1813061	269375	0.9	2.1	1.7	292547	50365	0.8	242182	0.8	0.4	1437	1195	198322	170350	0.5	777544	2574742	2226788	347954
S-250911-01822	0.2	18169	941937	1303579	1149241	154338	0.9	2.1	1.7	174513	26927	0.8	147586	0.8	0.4	580	458	113502	98098	0.5	277665	1592174	1395383	196791
S-250911-01840	0.4	24065	2634632	2016532	1754540	261992	0.9	2.1	1.5	278844	45397	0.8	233447	0.8	0.4	1351	1089	189761	163056	0.5	725045	2486488	2152132	334356
S-250911-01847	0.4	22687	2440211	1954702	1713112	241590	0.9	2.1	1.5	264858	41644	0.8	223214	0.8	0.4	1175	991	173732	149424	0.5	656755	2394467	2086741	307726
S-250911-01876	0.4	24540	3020523	2117522	1830567	286955	0.9	2.1	1.7	297089	50870	0.8	246219	0.8	0.4	1552	1286	202242	173512	0.5	801722	2618405	2251584	366821
S-250911-01883	0.4	22678	2572136	2002109	1754944	247165	0.9	2.1	1.7	277385	47250	0.8	230135	0.8	0.4	1356	1110	186055	158741	0.5	716243	2466905	2144930	321975
S-250911-01890	0.4	23451	3209137	2129002	1823512	305490	0.9	2.1	1.7	303156	55397	0.8	247759	0.8	0.4	1575	1288	208169	178506	0.5	815089	2641902	2251065	390837
S-250911-01903	0.4	20422	2645041	1946690	1695452	251238	0.9	2.0	1.8	280955	49614	0.8	231341	0.8	0.4	1372	1167	186857	160241	0.5	688780	2415874	2088201	327673
S-250911-01904	0.4	20939	2520581	1947887	1673496	274391	0.9	2.1	1.4	268756	46624	0.8	222132	0.8	0.4	1262	1042	178258	152012	0.5	672068	2396163	2048682	347481
S-250911-01911	0.4	23670	3132930	2250411	1962087	288324	0.9	2.1	1.7	306086	55713	0.8	250373	0.8	0.4	1635	1334	194702	163502	0.5	796547	2752834	2377296	375538
S-250911-01918	0.3	18153	1482539	1509361	1303739	205622	0.9	2.1	1.4	206589	35096	0.8	171493	0.8	0.4	727	583	133161	114427	0.5	408637	1849838	1590242	259596
S-250911-01925	0.5	23033	3500589	2241366	1923173	318193	0.9	2.0	1.4	309774	53032	0.8	256742	0.8	0.4	1621	1353	207351	177483	0.5	892279	2760112	2358751	401361
S-250911-01933	0.5	23918	3920335	2381017	2095622	285395	0.9	2.1	1.6	336227	56333	0.8	279894	0.8	0.4	1852	1568	230502	197680	0.5	1022469	2949598	2574764	374834
S-250911-01940	0.4	31294	1736332	1872820	1733454	139366	0.9	2.1	1.4	270359	38455	0.9	231904	0.8	0.5	1112	967	193898	166142	0.5	636978	2338189	2132467	205722
S-250911-01968	0.2	17885	1146708	1362449	1197317	165132	0.9	2.1	1.7	185240	29964	0.8	155276	0.8	0.4	638	512	116304	100247	0.5	330097	1664631	1453352	211279
S-250911-01975	0.3	18990	1295935	1444348	1251050	193298	0.9	2.1	1.6	195681	32091	0.8	163590	0.8	0.4	792	620	126494	109024	0.5	371681	1767315	1524284	243031
S-250911-02080	0.4	25972	2000826	1834755	1646412	188343	0.9	2.1	1.6	248057	37437	0.8	210620	0.8	0.4	1052	895	161768	139627	0.5	587589	2245632	1997554	248078
S-250911-02235	0.3	21144	2223455	1883679	1630844	252835	0.9	2.1	1.6	237878	38008	0.8	199870	0.8	0.4	1093	901	141993	122049	0.5	575422	2264643	1953664	310979
S-250911-02256	0.5	25183	3890905	2347512	2017647	329865	0.9	2.0	1.7	333442	59249	0.8	274193	0.8	0.4	1865	1591	229049	195913	0.5	982620	2911868	2489344	422524
S-250911-02271	0.4	22341	2970877	2049137	1771243	277894	0.9	2.1	1.7	275125	47594	0.8	227531	0.8	0.4	1364	1114	170015	146685	0.5	731018	2495641	2146573	349068
S-250911-02295	0.5	25125	3146112	2173164	1890568	282596	0.9	2.1	1.8	296398	49651	0.8	246747	0.8	0.4	1531	1271	194679	167353	0.5	830708	2665772	2305939	359833
S-250911-02305	0.5	25356	3733103	2380536	2083616	296920	0.9	2.1	1.7	331267	58471	0.8	272796	0.8	0.4	1703	1423	219080	185950	0.5	970609	2932586	2543785	388801
S-250911-02312	0.5	25449	3738906	2380696	2094244	286452	0.9	2.1	1.6	331637	57249	0.8	274388	0.8	0.4	1817	1532	220234	187214	0.5	974866	2934384	2557378	377006
S-250911-02319	0.4	23600	3154676	2164576	1882315	282261	0.9	2.1	1.7	286694	46262	0.8	240432	0.8	0.4	1394	1193	180763	156055	0.5	802502	2633427	2279995	353432
S-250911-02326	0.5	26663	4103346	2412231	2092959	319272	0.9	2.1	1.6	341664	58648	0.8	283016	0.8	0.4	1939	1636	237938	204356	0.5	1050004	2993772	2581967	411805
S-250911-02340	0.2	21029	1166329	1275040	1061027	214013	0.8	2.1	2.0	177753	33899	0.8	143854	0.9	0.4	706	571	123886	106892	0.6	313889	1577385	1312344	265041
S-250911-02348	0.4	24226	3072791	2121564	1859879	261685	0.9	2.1	1.6	296515	49360	0.8	247155	0.8	0.4	1508	1244	198030	170196	0.5	808308	2617617	2278474	339143
S-250911-02355	0.4	22572	3111783	2104413	1812608	291805	0.9	2.1	1.5	291570	50343	0.8	241227	0.8	0.4	1453	1200	197116	168986	0.5	792061	2594552	2224021	370531
S-250911-02362	0.4	22979	2688813	2017113	1737315	279798	0.9	2.1	1.6	266041	43904	0.8	222137	0.8	0.4	1288	1078	168139	145161	0.5	703442	2452581	2105691	346890
S-250911-02384	0.3	20170	2124568	1689120	1473311	215809	0.9	2.1	1.7	197093	31468	0.8	165625	0.8	0.4	877	692	106277	91025	0.6	481552	1993367	1730653	262714
S-250911-02392	0.3	20504	2090798	1763180	1533279	229901	0.9	2.1	1.7	235672	39405	0.8	196267	0.8	0.4	989	810	146612	126616	0.5	540951	2146453	1856972	289481
S-250911-02393	0.5	23774	3194669	2155838	1878601	277237	0.9	2.1	1.8	306692	53201	0.8	253491	0.8	0.4	1594	1305	210071	180118	0.5	836845	2674195	2313515	360680
S-250915-02677	0.4	26380	1969733	1869346	1674243	195103	0.9	2.1	1.5	250207	37543	0.8	212664	0.8	0.4	1058	873	160450	138176	0.5	601291	2281061	2025956	255105
S-250915-02684	0.3	18757	1363117	1482698	1269530	213168	0.9	2.1	1.6	204749	35569	0.8	169180	0.8	0.4	770	622	134718	115480	0.5	389971	1822935	1554812	268123
S-250915-02705	0.4	29424	2145117	1954387	1779119	175268	0.9	2.1	1.4	283251	42100	0.9	241151	0.8	0.5	1212	1028	201564	172810	0.5	688509	2440414	2194108	246306
S-250915-02713	0.4	31053	1966054	1969160	1794158	175002	0.9	2.1	1.0	279228	39335	0.9	239893	0.8	0.5	1182	1011	195350	167242	0.5	694387	2444920	2202304	242616
S-250915-02720	0.2	17748	1139625	1379041	1176493	202548	0.9	2.1	1.3	178946	28662	0.8	150284	0.8	0.4	631	472	110106	95006	0.5	332875	1668724	1422255	246469
S-250915-02746	0.2	16852	1148263	1358730	1184391	174339	0.9	2.1	1.5	172162	26375	0.8	145787	0.8	0.4	571	448	100800	87290	0.5	319020	1632263	1417916	214347
S-250915-02785	0.4	27249	2156806	1936445	1710768	225677	0.9	2.0	1.2	277205	43606	0.8	233599	0.8	0.4	1364	1157	196026	167889	0.5	671967	2411040	2113413	297627
S-250915-02792	0.3	17247	1169400	1374923	1166140	208783	0.8	2.1	1.2	182026	29753	0.8	152273	0.8	0.4	678	515	116591	100115	0.5	338667	1674218	1419043	255175
S-250915-02808	0.4	29505	1673517	1810902	1646649	164253	0.9	2.1	1.2	257693	38305	0.9	219388	0.8	0.5	1107	966	179136	152648	0.5	594133	2248838	2019651	229187
S-250915-02815	0.3	27168	1562117	1706184	1534417	171767	0.9	2.1	1.2	243190	35802	0.9	207388	0.8	0.4	978	836	168628	145465	0.5	521526	2118980	1888106	230874
S-250915-02825	0.2	15546	896471	1180186	1008981	171205	0.9	2.1	1.4	148717	23975	0.8	124742	0.8	0.4	474	354	88493	76423	0.5	252280	1417870	1210500	207370
S-250915-02837	0.2	19245	1088032	1278602	1129411	149191	0.9	2.1	1.6	159880	25142	0.8	134738	0.9	0.4	711	561	86904	73766	0.5	288061	1526097	1338476	187621
S-250915-02855	0.4	28585	2121362	1928508	1712472	216036	0.9	2.0	1.3	279091	44205	0.8	234886	0.8	0.4	1292	1110	199245	171150	0.5	671632	2408136	2119618	288518
S-250915-02856	0.4	26451	1984424	1864630	1637902	226728	0.9	2.1	1.1	251051	37509	0.9	213542	0.8	0.4	1062	881	166349	143392	0.5	594616	2283092	1995717	287375
S-250915-02863	0.4	27660	2268967	1957811	1733530	224281	0.9	2.1	1.3	281018	44346	0.8	236672	0.8	0.4	1322	1100	199339	170915	0.5	686833	2439490	2142217	297273
S-250915-02870	0.2	17462	1151359	1361849	1151122	210727	0.8	2.1	1.2	171592	27007	0.8	144585	0.8	0.4	658	504	103666	89608	0.5	320857	1637765	1385819	251946
S-250915-02958	0.2	18480	1049649	1323465	1164956	158509	0.9	2.1	1.7	174618	27660	0.8	146958	0.8	0.4	572	429	106745	92215	0.5	307225	1605400	1404558	200842
S-250915-03124	0.3	28352	1667049	1767276	1587718	179558	0.9	2.1	1.3	240255	34497	0.9	205758	0.8	0.5	959	820	160895	138976	0.5	543429	2169385	1933272	236113
S-250915-03151	0.4	28803	2351734	2001519	1795530	205989	0.9	2.1	1.5	292137	46381	0.8	245756	0.8	0.4	1481	1285	209218	179365	0.5	725720	2504355	2221936	282419
S-250915-03181	0.4	24057	2512678	1979816	1720078	259738	0.9	2.1	1.5	263670	43161	0.8	220509	0.8	0.4	1196	1019	172926	149027	0.5	689697	2417608	2090633	326975
S-250915-03191	0.2	17445	1064196	1285035	1121886	163149	0.9	2.1	1.7	175725	28648	0.8	147077	0.8	0.4	599	463	113561	97927	0.5	296660	1574920	1367353	207567
S-250915-03223	0.4	32385	2186952	2089555	1918353	171202	0.9	2.1	1.4	299311	46293	0.8	253018	0.8	0.5	1424	1185	207505	175507	0.5	755937	2597795	2348063	249732
S-250915-03227	0.4	24457	2666809	2035014	1781688	253326	0.9	2.0	1.6	286646	48118	0.8	238528	0.8	0.4	1289	1091	194394	167303	0.5	740198	2517343	2188610	328733
S-250915-03234	0.2	17583	1170838	1340600	1154073	186527	0.9	2.1	1.6	172074	28165	0.8	143909	0.8	0.4	689	523	104625	90415	0.5	313848	1617988	1388920	229068
S-250915-03241	0.3	20301	1493389	1559607	1368995	190612	0.9	2.1	1.6	209693	32873	0.8	176820	0.8	0.4	790	649	133815	115851	0.5	424922	1903905	1662315	241590
S-250915-03248	0.3	19274	1395447	1523417	1348385	175032	0.9	2.1	1.7	207692	32335	0.8	175357	0.8	0.4	841	663	133169	114795	0.5	410792	1865119	1639200	225919
S-250915-03255	0.3	20847	1353846	1512643	1312100	200543	0.9	2.0	1.4	203597	32017	0.8	171580	0.8	0.4	757	597	129316	110794	0.5	410775	1846313	1595071	251242
S-250915-03292	0.3	18862	1165344	1405097	1209812	195285	0.9	2.1	1.5	183045	29279	0.8	153766	0.8	0.4	653	499	115209	98994	0.5	346975	1704004	1463071	240933
S-250915-03299	0.3	28637	2087360	1996320	1788171	208149	0.9	2.1	1.3	277787	46385	0.8	231402	0.8	0.5	1384	1174	187622	157660	0.5	639944	2463113	2178407	284706
S-250915-03321	0.3	24911	1448462	1600733	1441101	159632	0.9	2.1	1.6	229670	35405	0.8	194265	0.8	0.4	964	788	157946	135986	0.5	460546	1989313	1772140	217173
S-250915-03343	0.3	26716	1804448	1839115	1627256	211859	0.9	2.1	1.1	252191	39922	0.8	212269	0.8	0.4	1055	902	164476	139841	0.5	577742	2256837	1980268	276569
S-250915-03365	0.4	30081	1936697	1911313	1756183	155130	0.9	2.1	1.3	277790	39324	0.9	238466	0.8	0.4	1209	1054	198330	171292	0.5	659193	2388642	2166995	221647
S-250915-03548	0.4	26525	1998142	1853132	1654900	198232	0.9	2.1	1.6	267536	42653	0.8	224883	0.8	0.4	1238	1051	189032	162178	0.5	609967	2310938	2043012	267926
S-250915-03555	0.3	18842	1329262	1447476	1270895	176581	0.9	2.1	1.6	187121	28475	0.8	158646	0.8	0.4	719	565	113156	98122	0.5	364594	1748472	1528228	220244
S-250915-03563	0.3	27411	1533534	1698037	1548108	149929	0.9	2.1	1.4	247142	36154	0.9	210988	0.8	0.5	992	827	176234	151387	0.5	519351	2122405	1911310	211095
S-250915-03570	0.2	15715	1014611	1262137	1106109	156028	0.9	2.1	1.7	169925	27605	0.8	142320	0.8	0.4	572	444	104483	90340	0.5	282955	1537117	1339213	197904
S-250915-03585	0.4	27508	2251881	1939857	1685010	254847	0.9	2.0	1.1	270566	42074	0.8	228492	0.8	0.4	1238	1065	188287	161880	0.5	675387	2399948	2076447	323501
S-250915-03592	0.4	31533	2131749	1966320	1787589	178731	0.9	2.0	1.3	286098	42431	0.9	243667	0.8	0.5	1352	1148	206991	177864	0.5	710404	2460761	2210268	250493
S-250915-03599	0.3	25493	1621387	1716254	1547906	168348	0.9	2.1	1.5	246550	37758	0.8	208792	0.8	0.4	1023	825	172469	147928	0.5	530195	2136296	1905451	230845
S-250915-03606	0.4	28461	2163950	1945746	1766859	178887	0.9	2.0	1.4	287241	43668	0.8	243573	0.8	0.4	1440	1207	208731	179175	0.5	694967	2443158	2190814	252344
S-250915-03613	0.3	25401	1767514	1731767	1526140	205627	0.9	2.0	1.3	243021	37875	0.8	205146	0.8	0.4	1016	843	165207	141868	0.5	534630	2141011	1873997	267014
S-250916-01672	0.2	17344	977078	1281481	1112864	168617	0.9	2.1	1.7	170094	27347	0.8	142747	0.8	0.4	592	446	106605	92333	0.5	291666	1558772	1348390	210382
S-250919-02861	0.4	28518	1695014	1787003	1630364	156639	0.9	2.1	1.3	262800	39030	0.9	223770	0.8	0.5	1136	968	188593	161661	0.5	583009	2239532	2016763	222769
S-250922-00761	0.3	24482	1481756	1651127	1493519	157608	0.9	2.1	1.4	223481	31700	0.9	191781	0.8	0.4	834	685	143521	124211	0.5	475514	2018963	1810196	208767
S-250922-00768	0.2	16930	1038494	1300266	1145577	154689	0.9	2.1	1.7	164192	25100	0.8	139092	0.8	0.4	574	447	96021	82910	0.5	292636	1561053	1368026	193027
S-250922-00775	0.4	29909	2364831	2149971	1945788	204183	0.9	2.1	1.5	300424	48683	0.8	251741	0.8	0.5	1462	1264	202212	170071	0.5	744396	2654069	2368864	285205
S-250922-00809	0.4	27666	2447302	2019492	1815592	203900	0.9	2.1	1.6	290260	45084	0.8	245176	0.8	0.4	1400	1176	205366	176011	0.5	738234	2516518	2237955	278563
S-250922-00839	0.4	31689	1774280	1856709	1723230	133479	0.9	2.1	1.3	270493	37791	0.9	232702	0.8	0.5	1073	932	191804	165143	0.5	630040	2320079	2122007	198072
S-250922-00846	0.3	27228	1642441	1734715	1571763	162952	0.9	2.1	1.5	250629	37452	0.9	213177	0.8	0.4	1049	893	176709	152262	0.5	546983	2163102	1938095	225007
S-250922-00940	0.4	27722	1961503	1877176	1703536	173640	0.9	2.1	1.5	267094	39423	0.9	227671	0.8	0.5	1196	990	185192	160033	0.5	631139	2330658	2092230	238428
S-250922-01015	0.2	17334	1174407	1370623	1187218	183405	0.9	2.1	1.8	179594	29399	0.8	150195	0.8	0.4	628	473	110130	95078	0.5	328691	1660975	1432964	228011
S-250922-01023	0.3	19933	1201133	1413309	1258071	155238	0.9	2.1	1.7	192863	29036	0.8	163827	0.8	0.4	622	493	124582	107849	0.5	356592	1731376	1530240	201136
S-250922-01030	0.3	19073	1148793	1406994	1258212	148782	0.9	2.1	1.7	191066	28632	0.9	162434	0.8	0.4	658	525	120498	104342	0.5	350865	1719216	1525513	193703
S-250922-01037	0.4	26843	1846736	1806988	1631008	175980	0.9	2.1	1.5	251589	37163	0.9	214426	0.8	0.4	1082	898	170889	147588	0.5	583569	2230548	1993920	236628
S-250922-01044	0.2	18001	1138298	1387120	1227298	159822	0.9	2.1	1.7	181968	27666	0.8	154302	0.8	0.4	668	515	112292	97240	0.5	335924	1682048	1479355	202693
S-250922-01051	0.4	28918	1797765	1821868	1662271	159597	0.9	2.1	1.5	262676	38435	0.9	224241	0.8	0.4	1134	974	186101	160265	0.5	595103	2271779	2047751	224028
S-250922-01135	0.4	26810	2124410	1889673	1690011	199662	0.9	2.1	1.6	273339	44039	0.8	229300	0.8	0.4	1242	1061	192320	164504	0.5	641032	2356574	2084876	271698
S-250922-01142	0.4	28345	1780470	1807892	1643628	164264	0.9	2.1	1.5	265162	40322	0.8	224840	0.8	0.4	1139	962	190303	163185	0.5	596276	2264496	2032615	231881
S-250922-01149	0.4	26019	1961962	1807939	1612661	195278	0.9	2.1	1.6	263143	43506	0.8	219637	0.8	0.4	1213	1027	185608	158851	0.5	594483	2257903	1992176	265727
S-250922-01156	0.4	25275	2087997	1870507	1674850	195657	0.9	2.1	1.6	264943	41028	0.8	223915	0.8	0.4	1155	980	180141	155374	0.5	622850	2316746	2055119	261627
S-250922-01164	0.3	28645	1674019	1775906	1633188	142718	0.9	2.1	1.4	257758	37298	0.9	220460	0.8	0.5	1031	887	180426	155246	0.5	571934	2215121	2009781	205340
S-250922-01171	0.2	16326	1115794	1321739	1143740	177999	0.9	2.1	1.7	182836	31431	0.8	151405	0.8	0.4	674	531	117439	100491	0.5	313510	1622688	1396167	226521
S-250922-01178	0.3	24219	1556929	1651930	1481340	170590	0.9	2.1	1.5	223195	33181	0.9	190014	0.8	0.4	879	750	145674	125608	0.5	474663	2021678	1797712	223966
S-250922-01190	0.3	19451	1178813	1422842	1275603	147239	0.9	2.1	1.8	196776	29706	0.8	167070	0.8	0.4	751	595	127136	109794	0.5	364751	1747505	1553062	194443
S-250922-01197	0.4	27710	1872879	1824145	1648199	175946	0.9	2.0	1.5	268440	42371	0.8	226069	0.8	0.4	1161	964	192021	164456	0.5	608094	2285767	2039688	246079
S-250922-01205	0.2	16947	1084877	1310996	1142857	168139	0.9	2.1	1.7	180819	30234	0.8	150585	0.8	0.4	695	531	118113	101535	0.5	305603	1610623	1395508	215115
S-250922-01217	0.3	25376	1899011	1801029	1612484	188545	0.9	2.1	1.5	244116	36183	0.9	207933	0.8	0.4	972	812	160417	138361	0.5	568288	2206534	1959590	246944
S-250922-01224	0.3	20882	1763992	1661807	1487409	174398	0.9	2.1	1.7	212743	31968	0.8	180775	0.8	0.4	852	671	122515	105474	0.5	469855	1997917	1774329	223588
S-250922-01232	0.2	17413	1065459	1320040	1154239	165801	0.9	2.1	1.6	167710	25875	0.8	141835	0.8	0.4	596	468	100136	86484	0.5	303457	1588482	1383026	205456
S-250922-01240	0.2	17368	1162144	1368739	1202881	165858	0.9	2.1	1.7	189101	30684	0.8	158417	0.8	0.4	704	539	121527	104346	0.5	333327	1680071	1466183	213888
S-250922-01247	0.2	17255	1171425	1350896	1169725	181171	0.9	2.1	1.8	182603	29483	0.8	153120	0.8	0.4	745	569	114735	98961	0.5	321394	1648979	1422375	226604
S-250922-01254	0.2	16813	1126252	1333342	1161034	172308	0.9	2.1	1.8	174479	28162	0.8	146317	0.8	0.4	613	449	104431	89884	0.5	310893	1612865	1397684	215181
S-250922-01284	0.3	28383	1672269	1794062	1643785	150277	0.9	2.1	1.5	261752	38192	0.9	223560	0.8	0.5	1115	967	187003	161036	0.5	573975	2243932	2029348	214584
S-250922-01291	0.3	26080	1879208	1793311	1606893	186418	0.9	2.1	1.6	257814	40900	0.8	216914	0.8	0.4	1139	940	180228	154272	0.5	575766	2232492	1979019	253473
S-250922-01298	0.4	29866	2750701	2034218	1823362	210856	0.9	2.1	1.5	301440	46738	0.8	254702	0.8	0.4	1583	1347	216287	186778	0.5	770012	2553528	2266189	287339
S-250922-01305	0.4	26881	2092569	1893702	1713623	180079	0.9	2.1	1.5	265396	39174	0.9	226222	0.8	0.4	1145	976	178643	154023	0.5	632320	2338886	2094844	244042
S-250922-01398	0.2	16397	1057561	1304597	1134843	169754	0.9	2.1	1.8	175537	28685	0.8	146852	0.8	0.4	598	444	110317	94811	0.5	301773	1591049	1376950	214099
S-250922-01405	0.4	28250	1760848	1811922	1648213	163709	0.9	2.1	1.5	259546	38129	0.9	221417	0.8	0.4	1103	943	184145	158672	0.5	593146	2256716	2029245	227471
S-250922-01441	0.4	24955	2220188	1871730	1663972	207758	0.9	2.1	1.7	245964	38166	0.8	207798	0.8	0.4	1043	846	154800	133206	0.5	604921	2273537	2005822	267715
S-250922-01448	0.4	26910	1855882	1825042	1655488	169554	0.9	2.1	1.6	253249	37326	0.9	215923	0.8	0.4	1104	914	170404	146804	0.5	589907	2249799	2019129	230670
S-250922-01455	0.3	19524	1176089	1408008	1253912	154096	0.9	2.1	1.6	193777	29342	0.8	164435	0.8	0.4	748	591	127251	110051	0.5	355511	1729784	1528989	200795
S-250922-01485	0.2	16491	1313653	1490512	1323783	166729	0.9	2.1	1.6	186418	29215	0.8	157203	0.8	0.5	730	520	103346	87732	0.5	351796	1781006	1569238	211768
S-250922-01985	0.4	28162	2191170	1928677	1737696	190981	0.9	2.1	1.6	279614	43961	0.8	235653	0.8	0.4	1339	1122	198992	170473	0.5	683229	2408622	2144944	263678
S-250922-01993	0.2	18298	1152352	1415307	1218874	196433	0.9	2.0	1.6	179621	28214	0.8	151407	0.8	0.4	670	519	106678	92389	0.5	319293	1702276	1463189	239087
S-250922-02001	0.4	26619	2082533	1868768	1685509	183259	0.9	2.1	1.6	269168	41690	0.8	227478	0.8	0.4	1222	1015	189119	161976	0.5	629609	2328277	2075978	252299
S-250922-02008	0.3	26450	1633098	1725419	1559982	165437	0.9	2.1	1.4	244789	36217	0.9	208572	0.8	0.4	967	804	171317	147412	0.5	537128	2142492	1916770	225722
S-250922-02015	0.4	27614	2426522	1976888	1770747	206141	0.9	2.1	1.5	274748	40994	0.9	233754	0.8	0.4	1350	1124	186793	162002	0.5	690031	2439779	2167627	272152
S-250922-02022	0.3	25182	1608366	1697089	1524920	172169	0.9	2.1	1.5	230615	34268	0.9	196347	0.8	0.4	901	759	151208	130609	0.5	505378	2079813	1852635	227178
S-250922-02029	0.3	17145	1264220	1394304	1212923	181381	0.9	2.1	1.8	192889	32433	0.8	160456	0.8	0.4	725	553	125680	107328	0.5	345677	1713598	1481260	232338
S-250922-02036	0.3	25432	1910593	1830996	1652065	178931	0.9	2.1	1.6	248744	36761	0.9	211983	0.8	0.4	1062	890	161629	139402	0.5	579946	2242431	2004340	238091
S-250922-02043	0.4	28276	2102135	1945347	1764001	181346	0.9	2.1	1.6	286310	44234	0.8	242076	0.8	0.5	1290	1085	204232	174929	0.5	688269	2437179	2182091	255088
S-251007-02444	0.4	29510	2460704	2050684	1825255	225429	0.9	2.0	1.3	298371	48043	0.8	250328	0.8	0.4	1423	1210	214475	183661	0.5	768808	2564953	2260454	304499
S-251007-02480	0.3	24952	1868120	1780351	1590966	189385	0.9	2.1	1.5	240600	36147	0.8	204453	0.8	0.4	1007	839	155107	133864	0.5	552033	2177065	1930122	246943
S-251007-02559	0.2	17480	920717	1225869	1059298	166571	0.9	2.0	1.6	170413	28552	0.8	141861	0.8	0.4	570	452	110636	95307	0.5	270947	1507488	1296918	210570

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: picard_variantcallingmetrics_table_table

Sort	Column	Description	ID
\|\|	Het/Hom Ratio	(count of hets)/(count of homozygous non-ref) for this sample	`variantcallingmetrics-HET_HOMVAR_RATIO`
\|\|	%GQ0	The percentage of variants in a particular sample that have a GQ score of 0.	`variantcallingmetrics-PCT_GQ0_VARIANTS`
\|\|	Total GQ0	The total number of variants in a particular sample that have a GQ score of 0.	`variantcallingmetrics-TOTAL_GQ0_VARIANTS`
\|\|	Total Het Depth	total number of reads (from AD field) for passing bi-allelic SNP hets for this sample	`variantcallingmetrics-TOTAL_HET_DEPTH`
\|\|	Total SNPs	The number of passing bi-allelic SNPs calls (i.e. non-reference genotypes) that were examined	`variantcallingmetrics-TOTAL_SNPS`
\|\|	dbSNP SNP count	The number of passing bi-allelic SNPs found in dbSNP	`variantcallingmetrics-NUM_IN_DB_SNP`
\|\|	Novel SNPs	The number of passing bi-allelic SNPS called that were not found in dbSNP	`variantcallingmetrics-NOVEL_SNPS`
\|\|	Filtered SNPs	The number of SNPs that are filtered	`variantcallingmetrics-FILTERED_SNPS`
\|\|	Fraction in dbSNP (SNPs)	The fraction of passing bi-allelic SNPs in dbSNP	`variantcallingmetrics-PCT_DBSNP`
\|\|	Ti/Tv ratio (dbSNP)	The Transition/Transversion ratio of the passing bi-allelic SNP calls made at dbSNP sites	`variantcallingmetrics-DBSNP_TITV`
\|\|	Ti/Tv ratio (Novel)	The Transition/Transversion ratio of the passing bi-allelic SNP calls made at non-dbSNP sites	`variantcallingmetrics-NOVEL_TITV`
\|\|	Indels (Total)	The number of passing indel calls that were examined	`variantcallingmetrics-TOTAL_INDELS`
\|\|	Indels (Novel)	The number of passing indels called that were not found in dbSNP	`variantcallingmetrics-NOVEL_INDELS`
\|\|	Indels (Filtered)	The number of indels that are filtered	`variantcallingmetrics-FILTERED_INDELS`
\|\|	% in dbSNP (Indels)	The fraction of passing indels in dbSNP	`variantcallingmetrics-PCT_DBSNP_INDELS`
\|\|	Indels (dbSNP)	The number of passing indels found in dbSNP	`variantcallingmetrics-NUM_IN_DB_SNP_INDELS`
\|\|	Indel Ratio (dbSNP)	The Insertion/Deletion ratio of the indel calls made at dbSNP sites	`variantcallingmetrics-DBSNP_INS_DEL_RATIO`
\|\|	Indel Ratio (Novel)	The Insertion/Deletion ratio of the indel calls made at non-dbSNP sites	`variantcallingmetrics-NOVEL_INS_DEL_RATIO`
\|\|	Multiallelic SNPs (Total)	The number of passing multi-allelic SNP calls that were examined	`variantcallingmetrics-TOTAL_MULTIALLELIC_SNPS`
\|\|	Multiallelic SNPs (dbSNP)	The number of passing multi-allelic SNPs found in dbSNP	`variantcallingmetrics-NUM_IN_DB_SNP_MULTIALLELIC`
\|\|	Complex Indels (Total)	The number of passing complex indel calls that were examined	`variantcallingmetrics-TOTAL_COMPLEX_INDELS`
\|\|	Complex Indels (dbSNP)	The number of passing complex indels found in dbSNP	`variantcallingmetrics-NUM_IN_DB_SNP_COMPLEX_INDELS`
\|\|	SNP Ref. Bias	The rate at which reference bases are observed at ref/alt heterozygous SNP sites	`variantcallingmetrics-SNP_REFERENCE_BIAS`
\|\|	Singletons	For summary metrics, the number of variants that appear in only one sample. For detail metrics, the number of variants that appear only in the current sample.	`variantcallingmetrics-NUM_SINGLETONS`
\|\|	Total Called	Total called variants	`variantcallingmetrics-total_called_variants`
\|\|	Total Called (known)	Total called variants with membership in dbSNP	`variantcallingmetrics-total_called_variants_known`
\|\|	Total Called (novel)	Total called variants at non-dbSNP sites	`variantcallingmetrics-total_called_variants_novel`

Variant Types

Variants that have been called, looking at variant types. Optionally filtered on label.

Only passing variants are shown (i.e. non-filtered).

SNPs are bi-allelic.

Complex InDels are both an insertion and a deletion.

Created with MultiQC

Variant Labels

Variants that have been called, comparing with known variant sites.

Only passing variants are shown (i.e. non-filtered).

Variants contain bi-allelic SNPs, multi-allelic SNPs, simple and complex inserts and deletions.

Created with MultiQC

Samtools

Toolkit for interacting with BAM/CRAM files.http://www.htslib.orgDOI: 10.1093/bioinformatics/btp352

Flagstat

This module parses the output from samtools flagstat

Created with MultiQC

Showing ³⁴⁴/₃₄₄ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Supplementary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
S-250505-00334_5c9da34f-036a-43a9-b672-bc063fee78e0	51.8M	51.8M	51.8M	0.1M	2.0M	51.7M	51.5M	51.7M	0.0M	0.1M	0.0M
S-250505-00686_d84aaaf9-a498-4323-8bbe-db0989b1a03e	34.3M	34.3M	34.3M	0.1M	2.2M	34.2M	34.0M	34.2M	0.0M	0.1M	0.0M
S-250505-00689_4bb6333b-66f5-4b5a-9d2b-2319c515a93e	46.6M	46.6M	46.6M	0.1M	2.7M	46.5M	46.2M	46.4M	0.0M	0.1M	0.1M
S-250519-00843_ef87e2f7-b7a4-4d95-b2d6-672c06e68943	31.1M	31.1M	31.1M	0.1M	1.5M	31.1M	30.9M	31.1M	0.0M	0.1M	0.0M
S-250603-01361_150c3496-e4a0-4944-bb82-78b699ec9d35	28.6M	28.6M	28.6M	0.1M	1.8M	28.6M	28.4M	28.5M	0.0M	0.1M	0.0M
S-250603-01362_e782ed11-b623-4fc6-8934-264b4011654f	28.0M	28.0M	28.0M	0.1M	1.8M	27.9M	27.7M	27.9M	0.0M	0.1M	0.0M
S-250603-01364_23781353-bebb-4338-935a-1c5934c79b4a	29.2M	29.2M	29.2M	0.1M	1.7M	29.1M	28.9M	29.1M	0.0M	0.1M	0.0M
S-250603-01368_ee8367a0-4f63-4a3f-9d47-881c3b97b97e	35.9M	35.9M	35.9M	0.1M	2.5M	35.8M	35.6M	35.8M	0.0M	0.1M	0.0M
S-250603-01369_6fcd990f-b370-41d4-b056-4b4433695684	29.0M	29.0M	29.0M	0.1M	1.8M	29.0M	28.8M	28.9M	0.0M	0.1M	0.1M
S-250603-01374_743e9e90-5e1b-49d9-b31c-ef674a145816	36.3M	36.3M	36.3M	0.1M	2.0M	36.2M	36.1M	36.2M	0.0M	0.1M	0.0M
S-250603-01375_cfd6f9a1-dd97-4041-bc56-46cfd2412cc8	50.1M	50.1M	50.1M	0.1M	4.3M	50.0M	49.6M	50.0M	0.0M	0.2M	0.1M
S-250603-01377_58cea1ec-460e-4c8b-8efe-5c1de181ea9e	30.9M	30.9M	30.9M	0.1M	2.1M	30.9M	30.7M	30.9M	0.0M	0.1M	0.0M
S-250603-01378_0744a261-c2c2-49b8-b09f-9d5a942348af	31.8M	31.8M	31.8M	0.1M	2.1M	31.7M	31.5M	31.7M	0.0M	0.1M	0.1M
S-250603-01379_05588894-b095-41c6-adc6-1b8db67e91c7	45.0M	45.0M	45.0M	0.1M	2.6M	44.9M	44.6M	44.8M	0.0M	0.1M	0.1M
S-250603-01380_df114a85-750a-42d8-859f-9bfdd6ae6029	31.0M	31.0M	31.0M	0.1M	1.2M	30.9M	30.7M	30.9M	0.0M	0.1M	0.1M
S-250603-01381_560359a6-e046-400e-b62e-3202865ae420	30.5M	30.5M	30.5M	0.1M	1.7M	30.4M	30.3M	30.4M	0.0M	0.1M	0.0M
S-250603-01385_4914b3de-1c91-47d9-9019-a854ea9e2abd	41.7M	41.7M	41.7M	0.1M	2.1M	41.6M	41.4M	41.6M	0.0M	0.1M	0.0M
S-250603-01387_730c7029-1b8c-44c8-920d-8553c08ef4f8	37.4M	37.4M	37.3M	0.1M	1.9M	37.3M	37.1M	37.3M	0.0M	0.1M	0.0M
S-250603-01388_65255e65-e0e9-4bcb-910d-daabbd8e6eab	37.4M	37.4M	37.3M	0.0M	2.8M	37.3M	37.0M	37.3M	0.0M	0.0M	0.0M
S-250603-01398_9bbbd46d-6098-429d-bc9a-8d310c6cc1c6	37.7M	37.7M	37.7M	0.1M	2.8M	37.6M	37.4M	37.6M	0.0M	0.1M	0.1M
S-250603-01402_5dad63d1-d394-4b5e-8820-d94d52032e8f	30.1M	30.1M	30.1M	0.1M	1.7M	30.0M	29.9M	30.0M	0.0M	0.1M	0.0M
S-250603-01404_e118daaf-9ef8-4d59-b50d-4821e8940e2a	36.7M	36.7M	36.7M	0.1M	1.7M	36.6M	36.5M	36.6M	0.0M	0.1M	0.1M
S-250605-00261_69f05be1-5bb5-4765-be27-f53a02a4746f	36.9M	36.9M	36.9M	0.1M	2.8M	36.8M	36.6M	36.8M	0.0M	0.1M	0.0M
S-250606-00019_bd855797-f48b-4624-9388-1a5db76d86e7	29.3M	29.3M	29.3M	0.1M	1.4M	29.2M	29.1M	29.2M	0.0M	0.1M	0.0M
S-250606-00024_9d811cd5-88ab-412e-be4a-693f251229b9	30.0M	30.0M	30.0M	0.1M	1.4M	30.0M	29.8M	29.9M	0.0M	0.1M	0.0M
S-250606-00039_60503236-1e0a-4d97-b448-9082443a61ad	32.8M	32.8M	32.8M	0.1M	2.1M	32.7M	32.6M	32.7M	0.0M	0.1M	0.0M
S-250606-00442_5f352b85-74a6-4ba3-ac49-a59addba694f	37.9M	37.9M	37.9M	0.1M	3.2M	37.8M	37.6M	37.8M	0.0M	0.1M	0.0M
S-250609-00565_980c9761-0937-414a-9b2e-093857e777d1	56.7M	56.7M	56.7M	0.1M	3.0M	56.5M	56.3M	56.5M	0.0M	0.1M	0.1M
S-250609-00570_af1dce7b-22e5-4244-bd0c-8cd28a45aed4	62.7M	62.7M	62.6M	0.1M	4.6M	62.5M	62.2M	62.5M	0.0M	0.1M	0.1M
S-250613-00111_fe739b0a-b570-4f79-a669-4b4a81b0d2b1	33.4M	33.4M	33.4M	0.1M	1.5M	33.3M	33.1M	33.3M	0.0M	0.1M	0.0M
S-250613-00114_a42729e4-4231-4eac-8a16-fc64f6f4299f	33.9M	33.9M	33.9M	0.1M	1.7M	33.8M	33.7M	33.8M	0.0M	0.1M	0.0M
S-250613-00115_c9e094ba-7306-4b93-97e3-fb91a46fb45e	29.5M	29.5M	29.5M	0.1M	1.6M	29.4M	29.3M	29.4M	0.0M	0.0M	0.0M
S-250613-00116_c8f8f7f3-bce6-4336-9f03-dbe4c18a0dd7	35.3M	35.3M	35.3M	0.1M	2.0M	35.2M	35.1M	35.2M	0.0M	0.1M	0.0M
S-250613-00117_cc3aa885-09f9-4204-a9aa-ada9ad933479	37.4M	37.4M	37.4M	0.1M	2.7M	37.4M	37.2M	37.3M	0.0M	0.1M	0.0M
S-250613-00119_db2c162c-e73c-4087-a2a4-ec3ed37723cd	32.5M	32.5M	32.5M	0.1M	1.9M	32.5M	32.3M	32.5M	0.0M	0.1M	0.0M
S-250613-00120_3a58994d-ef86-4bf8-a2b3-1382ab96b228	31.8M	31.8M	31.8M	0.1M	2.2M	31.7M	31.5M	31.7M	0.0M	0.1M	0.1M
S-250616-00311_75a9c348-6dad-41b3-9ff8-87ddbd5de317	37.5M	37.5M	37.5M	0.1M	1.9M	37.5M	37.3M	37.5M	0.0M	0.1M	0.0M
S-250616-00494_e93c48db-efe4-4277-a400-e2dc578bf8cb	34.9M	34.9M	34.9M	0.1M	1.9M	34.8M	34.6M	34.8M	0.0M	0.1M	0.1M
S-250616-00639_8b5b43fb-b764-48e6-b945-7054bf098773	30.3M	30.3M	30.3M	0.1M	1.8M	30.3M	30.1M	30.2M	0.0M	0.1M	0.1M
S-250616-00785_2347484d-3245-49a3-a7af-afc5d4d263f6	36.2M	36.2M	36.2M	0.1M	2.8M	36.2M	36.0M	36.2M	0.0M	0.1M	0.0M
S-250616-00786_79130f59-77d4-4335-a0a0-347fe3ee9551	32.6M	32.6M	32.6M	0.1M	1.7M	32.5M	32.3M	32.5M	0.0M	0.1M	0.0M
S-250616-00788_fd46cf13-cc10-42f1-9f06-adbbe2d9c346	30.5M	30.5M	30.5M	0.1M	2.2M	30.5M	30.3M	30.5M	0.0M	0.1M	0.0M
S-250616-00789_0faab632-c156-488f-a770-df34280733b0	37.8M	37.8M	37.8M	0.1M	2.4M	37.7M	37.5M	37.7M	0.0M	0.1M	0.0M
S-250616-00791_bc88f175-5a6f-4751-afe7-f8909776330d	29.3M	29.3M	29.3M	0.1M	1.3M	29.3M	29.1M	29.3M	0.0M	0.1M	0.0M
S-250616-00793_3487f1e4-af75-4b64-b56f-b526f92798fb	31.3M	31.3M	31.3M	0.1M	2.1M	31.2M	31.0M	31.2M	0.0M	0.1M	0.0M
S-250616-00795_9165584c-eec4-44a6-b0d5-a9fadc9a4ee9	38.1M	38.1M	38.1M	0.1M	2.8M	38.0M	37.7M	38.0M	0.0M	0.1M	0.1M
S-250616-00797_11c11567-6613-4baf-af92-c37b00f1680f	33.2M	33.2M	33.2M	0.1M	2.0M	33.1M	33.0M	33.1M	0.0M	0.1M	0.0M
S-250616-00798_4a5aa79d-8081-4a27-ba56-3c6222c41da6	35.7M	35.7M	35.7M	0.1M	2.4M	35.6M	35.4M	35.6M	0.0M	0.1M	0.0M
S-250617-00285_932db5da-af05-4885-897c-2a800b7c44ae	27.8M	27.8M	27.8M	0.1M	2.2M	27.7M	27.5M	27.7M	0.0M	0.1M	0.1M
S-250617-02155_44f6a14d-4927-4e7c-9d81-8c38e0db4dc2	30.1M	30.1M	30.1M	0.1M	1.6M	30.0M	29.9M	30.0M	0.0M	0.1M	0.0M
S-250618-01279_23b62d5d-54e8-444b-b3b5-3d551373d080	38.2M	38.2M	38.1M	0.1M	2.0M	38.1M	37.9M	38.1M	0.0M	0.1M	0.0M
S-250618-01293_2fdbb754-32af-4e80-8ca4-c6e20cd423d3	35.5M	35.5M	35.5M	0.1M	2.3M	35.4M	35.2M	35.4M	0.0M	0.1M	0.0M
S-250618-01294_189eb4c4-76d2-4219-9640-b05ab29a97d8	46.2M	46.2M	46.2M	0.1M	3.3M	46.1M	46.0M	46.1M	0.0M	0.1M	0.0M
S-250618-01295_8025e1c3-3271-4600-8a27-f9c815fd72d3	35.7M	35.7M	35.7M	0.1M	2.7M	35.7M	35.5M	35.7M	0.0M	0.1M	0.0M
S-250619-01389_49da55c5-9b79-4dc6-8a05-a7a9811d0176	32.1M	32.1M	32.1M	0.1M	2.2M	32.0M	31.8M	32.0M	0.0M	0.1M	0.0M
S-250623-00667_beb9f515-1306-491a-a9a7-462f808f7fe1	37.4M	37.4M	37.4M	0.1M	2.8M	37.3M	37.1M	37.3M	0.0M	0.1M	0.1M
S-250623-00668_a7e8022e-76e1-499d-be0f-5221c3101510	54.3M	54.3M	54.3M	0.1M	3.5M	54.2M	53.9M	54.1M	0.0M	0.1M	0.1M
S-250623-00669_674129f1-6d9a-4a24-8f11-b65712e9afa9	32.2M	32.2M	32.2M	0.1M	2.2M	32.2M	32.0M	32.1M	0.0M	0.1M	0.1M
S-250623-00670_3825b221-fd4d-4225-a02f-b901c2c29b7e	27.9M	27.9M	27.9M	0.1M	1.5M	27.8M	27.7M	27.8M	0.0M	0.1M	0.0M
S-250623-00672_463927f8-1553-4a21-af11-5e78f42cf58b	29.9M	29.9M	29.9M	0.1M	1.7M	29.8M	29.6M	29.8M	0.0M	0.1M	0.1M
S-250623-00673_7df3b641-922c-4692-be76-22299fd5d983	37.0M	37.0M	37.0M	0.1M	2.2M	36.9M	36.7M	36.9M	0.0M	0.1M	0.1M
S-250623-00674_69eb75d6-60e8-4698-a9e5-b7d2f480a261	36.0M	36.0M	36.0M	0.1M	2.1M	35.9M	35.7M	35.9M	0.0M	0.1M	0.1M
S-250623-00676_915137fd-8e03-448f-a7c2-3804f911ffa9	29.4M	29.4M	29.4M	0.1M	1.8M	29.3M	29.2M	29.3M	0.0M	0.1M	0.0M
S-250623-00679_c5b2a0f9-25cf-4279-af2e-5aa637fe780f	39.1M	39.1M	39.1M	0.1M	2.7M	39.0M	38.7M	39.0M	0.0M	0.1M	0.1M
S-250623-00680_f7c88670-d59b-4693-97c7-88a5070e39d9	29.7M	29.7M	29.7M	0.1M	2.1M	29.6M	29.4M	29.6M	0.0M	0.1M	0.0M
S-250623-00682_f77b11b5-f09c-4be6-969a-9a9ce2ecbb17	39.5M	39.5M	39.5M	0.1M	2.4M	39.4M	39.2M	39.4M	0.0M	0.1M	0.0M
S-250623-00686_c60ee5bb-a36b-4e08-ac8f-ef222eee58fc	28.2M	28.2M	28.2M	0.1M	1.4M	28.1M	28.0M	28.1M	0.0M	0.1M	0.0M
S-250623-00687_0663013e-d536-4261-98ae-91dd99ef2550	39.3M	39.3M	39.3M	0.1M	2.2M	39.2M	39.0M	39.2M	0.0M	0.1M	0.0M
S-250624-00049_593382fc-2a6f-4c93-b09c-6147d663a417	36.8M	36.8M	36.8M	0.1M	3.0M	36.7M	36.3M	36.6M	0.0M	0.1M	0.1M
S-250624-00523_a56fce7e-90a4-4e2c-a7f7-24a153d6bd6c	44.6M	44.6M	44.6M	0.1M	2.6M	44.5M	44.3M	44.5M	0.0M	0.1M	0.0M
S-250625-00890_dd602a38-afcf-44de-97fa-09e0cbeb6ee1	42.2M	42.2M	42.2M	0.1M	2.7M	42.1M	41.9M	42.1M	0.0M	0.1M	0.0M
S-250626-00449_a49ab0e5-3781-42a5-81d4-a3bfc13e0d06	55.4M	55.4M	55.4M	0.1M	4.0M	55.3M	55.0M	55.3M	0.0M	0.1M	0.1M
S-250626-00583_2477da27-4a71-41cc-932a-ffc477fea424	44.0M	44.0M	44.0M	0.1M	2.9M	43.9M	43.8M	43.9M	0.0M	0.1M	0.0M
S-250626-00839_54b0d9a3-458a-4c9d-8416-71372d16416b	59.6M	59.6M	59.6M	0.2M	5.5M	59.5M	59.1M	59.4M	0.0M	0.2M	0.1M
S-250627-00861_b4aa27da-fd30-49d3-a5fd-b2ff3913468d	39.6M	39.6M	39.6M	0.1M	2.7M	39.5M	39.3M	39.5M	0.0M	0.1M	0.0M
S-250627-00911_a4722dbd-a9dc-4489-9153-bf196b9e2276	46.7M	46.7M	46.7M	0.1M	3.0M	46.6M	46.4M	46.6M	0.0M	0.1M	0.1M
S-250630-00532_bb72f0f6-4428-4bbc-9fb1-0ef9f9d3d586	38.0M	38.0M	38.0M	0.1M	2.0M	37.9M	37.7M	37.9M	0.0M	0.1M	0.0M
S-250701-00032_2d03b23b-ec60-4778-bc7b-f8019bf2553b	42.7M	42.7M	42.7M	0.1M	2.2M	42.6M	42.4M	42.6M	0.0M	0.1M	0.1M
S-250701-00046_30643e3a-7f4d-4475-ac28-bf2a5b37a740	71.3M	71.3M	71.3M	0.2M	5.1M	71.2M	70.8M	71.1M	0.0M	0.2M	0.1M
S-250701-00084_bc231909-d837-42c4-b65a-7d4b1f5bb7be	59.3M	59.3M	59.3M	0.2M	4.9M	59.1M	58.8M	59.1M	0.0M	0.2M	0.1M
S-250701-00109_29722f82-b8a8-41eb-9c53-dee23832727e	42.7M	42.7M	42.6M	0.1M	2.2M	42.6M	42.4M	42.6M	0.0M	0.1M	0.0M
S-250701-00110_9e62f2ee-b15b-488d-b871-7503a54a3b3a	53.5M	53.5M	53.5M	0.1M	2.9M	53.4M	53.1M	53.4M	0.0M	0.2M	0.1M
S-250701-00112_cc86b201-4f3b-4b72-b25b-741eecdebdd8	49.4M	49.4M	49.4M	0.1M	3.3M	49.3M	49.1M	49.3M	0.0M	0.1M	0.1M
S-250701-00113_5d875162-c138-4eda-a83a-9bd2c064cd85	47.3M	47.3M	47.3M	0.1M	3.0M	47.2M	47.0M	47.2M	0.0M	0.1M	0.1M
S-250701-00114_522c4df3-cc89-4715-a4ae-af9ad9e8627b	69.5M	69.5M	69.5M	0.2M	5.7M	69.3M	69.0M	69.3M	0.0M	0.2M	0.1M
S-250701-00115_51e0667d-5371-4e5e-be13-87c770743ee5	52.7M	52.7M	52.7M	0.1M	3.7M	52.6M	52.4M	52.6M	0.0M	0.1M	0.1M
S-250701-00116_6c6f9b82-63da-4844-8d3c-ce0b08dd459b	42.6M	42.6M	42.6M	0.1M	2.5M	42.5M	42.3M	42.5M	0.0M	0.1M	0.1M
S-250701-00117_d2d09879-8c3f-46e5-bcad-3103311aab27	42.4M	42.4M	42.3M	0.1M	1.6M	42.3M	42.1M	42.3M	0.0M	0.1M	0.0M
S-250701-00118_9607b90c-15fc-4b2e-9d88-d325c219dbeb	46.3M	46.3M	46.3M	0.1M	2.3M	46.2M	46.0M	46.2M	0.0M	0.1M	0.1M
S-250701-00119_6b0bc8c3-e0e7-4c8e-a1b3-a75c7a8ee833	31.4M	31.4M	31.4M	0.1M	1.6M	31.3M	31.1M	31.3M	0.0M	0.1M	0.1M
S-250701-00120_3e6e8956-1ecb-421e-be7a-c00c59b4b6c9	45.6M	45.6M	45.6M	0.1M	3.8M	45.5M	45.2M	45.5M	0.0M	0.1M	0.1M
S-250701-00790_ee9540a9-68dc-4c7f-996f-416bc33900a0	41.7M	41.7M	41.7M	0.1M	2.3M	41.6M	41.5M	41.6M	0.0M	0.1M	0.0M
S-250702-00132_df7e18ea-a71e-43fc-bcd0-08adf555e889	34.8M	34.8M	34.8M	0.1M	2.3M	34.7M	34.6M	34.7M	0.0M	0.1M	0.0M
S-250702-00140_0e297b6c-2652-4809-bdff-40c4928700d9	37.1M	37.1M	37.1M	0.1M	2.1M	37.0M	36.8M	37.0M	0.0M	0.1M	0.1M
S-250702-01152_b7027206-8ef6-457c-93cc-2500864af55d	53.6M	53.6M	53.6M	0.1M	2.7M	53.5M	53.2M	53.4M	0.0M	0.1M	0.1M
S-250702-01169_ed26ee63-0e93-49fb-a3f2-904d50b21de1	40.2M	40.2M	40.2M	0.1M	2.2M	40.1M	39.9M	40.1M	0.0M	0.1M	0.1M
S-250702-01252_6a6c1bda-0256-445e-85f7-c45b7d60cac8	44.2M	44.2M	44.2M	0.1M	3.5M	44.1M	43.9M	44.1M	0.0M	0.1M	0.1M
S-250702-01259_2eb2b5a5-c93c-4c57-b0e8-c2ba1bfbdffb	46.1M	46.1M	46.0M	0.1M	2.9M	45.9M	45.7M	45.9M	0.0M	0.1M	0.1M
S-250702-01266_222878b9-2e84-4aea-a631-5fd9b8290a1a	38.7M	38.7M	38.7M	0.1M	3.2M	38.6M	38.4M	38.6M	0.0M	0.1M	0.1M
S-250702-01290_8877914b-e0ff-4c28-a293-bab12dfdf683	51.4M	51.4M	51.4M	0.1M	3.9M	51.3M	51.1M	51.3M	0.0M	0.1M	0.1M
S-250702-01308_c73b5d9b-ee41-4233-89c8-6e323f0f70a2	40.4M	40.4M	40.4M	0.1M	2.8M	40.3M	40.1M	40.3M	0.0M	0.1M	0.1M
S-250707-01209_5a970f5d-d29a-4595-a737-de80b6a13a7b	46.4M	46.4M	46.4M	0.1M	3.4M	46.3M	46.1M	46.3M	0.0M	0.1M	0.0M
S-250707-01210_e2cbd346-e8f8-4273-88a5-555243c66ec4	43.0M	43.0M	43.0M	0.1M	2.0M	42.9M	42.7M	42.9M	0.0M	0.1M	0.1M
S-250707-01211_b42d1d36-e4cc-4e18-90eb-ccb3d6a0002b	34.5M	34.5M	34.5M	0.1M	1.3M	34.5M	34.3M	34.5M	0.0M	0.1M	0.0M
S-250707-01212_e4387eff-e432-4cc8-85ed-68690667cb1b	45.2M	45.2M	45.2M	0.1M	3.0M	45.1M	44.9M	45.1M	0.0M	0.1M	0.1M
S-250707-01213_7f698bde-0e62-4e9b-aefe-caef0a7eed1c	34.7M	34.7M	34.7M	0.1M	2.2M	34.6M	34.5M	34.6M	0.0M	0.1M	0.0M
S-250707-01214_b3212505-b986-4b67-94aa-55303b7a01fe	46.9M	46.9M	46.9M	0.1M	3.3M	46.8M	46.5M	46.8M	0.0M	0.1M	0.1M
S-250707-01215_8f4f29fb-8001-4183-9ec9-7e698ac91af8	53.3M	53.3M	53.3M	0.1M	3.1M	53.2M	52.9M	53.2M	0.0M	0.1M	0.1M
S-250707-01216_0c1dc0fc-d8e9-41cb-af77-f917f8e295c8	42.4M	42.4M	42.4M	0.1M	2.5M	42.3M	42.1M	42.3M	0.0M	0.1M	0.1M
S-250707-01218_5712d6f2-842e-4f36-aa6e-456677a01966	50.7M	50.7M	50.7M	0.1M	2.8M	50.6M	50.3M	50.6M	0.0M	0.1M	0.1M
S-250707-01219_4993e89c-8055-4595-8e81-1863b9592bfd	45.3M	45.3M	45.3M	0.1M	2.2M	45.2M	45.0M	45.2M	0.0M	0.1M	0.1M
S-250707-01220_03152d49-8ca3-412d-8fd4-4b11be585047	37.9M	37.9M	37.9M	0.1M	2.2M	37.8M	37.6M	37.8M	0.0M	0.1M	0.1M
S-250707-01221_cc2bda86-6ae3-41bf-931f-924062266f09	60.1M	60.1M	60.1M	0.1M	4.4M	60.0M	59.7M	59.9M	0.0M	0.1M	0.1M
S-250707-01222_9448d7ab-4770-4f78-9ee1-732a41e1cbbe	47.8M	47.8M	47.8M	0.1M	3.6M	47.7M	47.5M	47.7M	0.0M	0.1M	0.1M
S-250707-01223_67115096-73cc-4e71-8f77-fca5a886e436	49.1M	49.1M	49.1M	0.1M	3.6M	49.0M	48.8M	49.0M	0.0M	0.1M	0.1M
S-250707-01224_9cb1393c-93ea-4161-af22-8fe0fe420a84	39.4M	39.4M	39.4M	0.1M	2.8M	39.3M	39.1M	39.3M	0.0M	0.1M	0.1M
S-250707-01225_e239e038-0ba3-4699-b6b4-19d994c0e7f4	39.3M	39.3M	39.3M	0.1M	3.5M	39.2M	38.9M	39.2M	0.0M	0.1M	0.1M
S-250707-01226_ddf066e1-e625-4942-814c-5fa013cd3af7	51.0M	51.0M	51.0M	0.1M	2.9M	50.8M	50.6M	50.8M	0.0M	0.1M	0.1M
S-250707-01227_4fe9d862-d64a-4fe5-adfa-848c664b5de7	37.0M	37.0M	37.0M	0.1M	2.4M	36.9M	36.7M	36.9M	0.0M	0.1M	0.1M
S-250707-01228_5172402e-2aba-46fb-afb1-ba20c6974b13	51.1M	51.1M	51.1M	0.1M	5.4M	51.0M	50.6M	51.0M	0.0M	0.1M	0.1M
S-250707-01229_5e30e739-0cc8-4531-9ff1-726b5d936fc6	40.3M	40.3M	40.3M	0.1M	3.4M	40.2M	40.0M	40.2M	0.0M	0.1M	0.1M
S-250707-01230_ddd53f9d-0119-4983-bbc0-87eebfd68f84	43.9M	43.9M	43.9M	0.1M	2.9M	43.8M	43.6M	43.8M	0.0M	0.1M	0.1M
S-250707-01235_f95142f7-1b94-42e4-8586-b928047ab9c8	38.1M	38.1M	38.1M	0.1M	1.8M	38.0M	37.8M	38.0M	0.0M	0.1M	0.0M
S-250709-00653_9e4dc10d-af1c-4cff-8c43-30f8740f713f	43.2M	43.2M	43.2M	0.1M	2.3M	43.1M	42.9M	43.1M	0.0M	0.1M	0.0M
S-250711-00769_dc641885-5093-4b53-83e6-a927cfcdeee0	49.4M	49.4M	49.4M	0.1M	2.4M	49.3M	49.1M	49.3M	0.0M	0.1M	0.1M
S-250711-00770_4d0e82c3-c188-40bd-a959-c9e7f02b26f0	40.0M	40.0M	40.0M	0.1M	2.4M	39.9M	39.7M	39.9M	0.0M	0.1M	0.1M
S-250711-00777_fcf3eb86-6823-44c4-b1cc-4f5253154de4	38.6M	38.6M	38.6M	0.1M	2.5M	38.5M	38.3M	38.5M	0.0M	0.1M	0.1M
S-250711-00784_6ecfdd3a-e4d3-46fd-bd2d-1e9852bcfaa4	39.3M	39.3M	39.2M	0.1M	2.3M	39.2M	39.0M	39.1M	0.0M	0.1M	0.1M
S-250711-00792_d3aaaf9d-f987-48bc-851d-79709a612967	42.6M	42.6M	42.6M	0.1M	3.3M	42.5M	42.3M	42.5M	0.0M	0.1M	0.0M
S-250711-00800_fa7e87ff-c30d-4c2f-8e65-10ae4372b964	38.4M	38.4M	38.4M	0.1M	2.1M	38.3M	38.2M	38.3M	0.0M	0.1M	0.0M
S-250711-00814_9ef89c8f-26ba-4692-a778-4f7fcbec27ca	47.6M	47.6M	47.6M	0.1M	3.3M	47.4M	47.2M	47.4M	0.0M	0.1M	0.1M
S-250711-00830_94a5317f-9cdc-411d-b4f2-bff28582ad82	47.8M	47.8M	47.8M	0.1M	3.4M	47.7M	47.5M	47.7M	0.0M	0.1M	0.1M
S-250711-00837_a63f0fbf-800d-4220-be05-9b3fd118bc70	48.6M	48.6M	48.6M	0.1M	3.5M	48.5M	48.3M	48.5M	0.0M	0.1M	0.1M
S-250711-00844_ac0fb391-2fb2-44e4-971e-3c7f0333d454	45.6M	45.6M	45.5M	0.1M	4.4M	45.4M	45.1M	45.4M	0.0M	0.2M	0.1M
S-250714-00495_59d70165-546e-4bc1-8486-22db13fad321	32.6M	32.6M	32.6M	0.1M	2.8M	32.6M	32.4M	32.6M	0.0M	0.1M	0.0M
S-250714-00829_c0c03acd-e0c0-423c-bd12-5c2a3c1bf8e6	49.1M	49.1M	49.1M	0.1M	4.3M	49.0M	48.6M	48.9M	0.0M	0.2M	0.1M
S-250714-00830_07459a3a-57eb-4354-9eec-8205b07c1251	31.5M	31.5M	31.5M	0.1M	2.2M	31.4M	31.3M	31.4M	0.0M	0.1M	0.0M
S-250714-00831_19ba6f99-02ef-4a18-9301-20c7d42fb2bf	33.3M	33.3M	33.2M	0.1M	2.1M	33.2M	33.0M	33.2M	0.0M	0.1M	0.0M
S-250714-00832_4de3ce50-163b-4589-979e-a949e5e30e38	38.6M	38.6M	38.6M	0.1M	2.3M	38.5M	38.4M	38.5M	0.0M	0.1M	0.1M
S-250714-00833_ee920a60-a966-4ce1-b943-57680171848f	35.3M	35.3M	35.3M	0.1M	1.7M	35.2M	35.0M	35.2M	0.0M	0.1M	0.1M
S-250714-00834_a0dafcb9-7967-45f8-b9c5-f579f12f5559	40.5M	40.5M	40.5M	0.1M	2.2M	40.4M	40.3M	40.4M	0.0M	0.1M	0.1M
S-250714-00835_3a626437-9548-4772-a710-1e212ad75a90	41.5M	41.5M	41.5M	0.1M	2.2M	41.4M	41.2M	41.4M	0.0M	0.1M	0.1M
S-250714-00836_3592fc0f-b1a3-43e9-a167-9e6d1f59372b	44.3M	44.3M	44.3M	0.1M	2.2M	44.2M	44.0M	44.2M	0.0M	0.1M	0.1M
S-250714-00837_70a60fdf-b598-497f-9a07-23a890a3583f	50.1M	50.1M	50.1M	0.1M	3.6M	50.0M	49.8M	50.0M	0.0M	0.1M	0.1M
S-250714-00838_d1cb4f4d-9536-4eb6-8ba0-8bb88cf12272	35.5M	35.5M	35.4M	0.1M	2.3M	35.4M	35.2M	35.4M	0.0M	0.1M	0.1M
S-250806-00453_a69fbaae-8e0b-4fdc-aae6-58e2387449ac	68.9M	68.9M	68.9M	0.1M	4.0M	68.9M	68.6M	68.8M	0.0M	0.1M	0.0M
S-250806-00458_d19a2b30-fb63-42de-8805-42c28c5911bd	77.6M	77.6M	77.5M	0.1M	3.8M	77.5M	77.1M	77.4M	0.0M	0.1M	0.1M
S-250808-00180_a94c3aa1-4e54-4ecd-b90f-1af2fd6587cb	62.7M	62.7M	62.6M	0.1M	4.5M	62.6M	62.3M	62.6M	0.0M	0.1M	0.0M
S-250808-01397_598be49b-3128-4226-96c0-04da92808866	57.2M	57.2M	57.2M	0.1M	3.7M	57.1M	56.9M	57.1M	0.0M	0.1M	0.0M
S-250808-01457_1fc94014-3574-45f1-8643-fbd5f7bbcacd	66.1M	66.1M	66.1M	0.1M	4.2M	66.0M	65.7M	66.0M	0.0M	0.1M	0.0M
S-250808-01486_78dec13c-0661-4900-9907-b13f5a0bf9e3	107.7M	107.7M	107.6M	0.1M	8.3M	107.5M	107.1M	107.4M	0.0M	0.1M	0.1M
S-250814-00600_f5736333-1c1c-40f7-999f-74e13eba3e6c	121.1M	121.1M	121.1M	0.1M	5.3M	121.0M	120.5M	120.9M	0.0M	0.2M	0.1M
S-250814-00606_7cf890c7-4a38-471d-8db7-001f935a091b	63.5M	63.5M	63.4M	0.1M	4.1M	63.4M	62.9M	63.3M	0.0M	0.1M	0.0M
S-250814-00618_27488b61-6d9f-4a6c-aea4-ec9b26e0b36c	65.7M	65.7M	65.7M	0.1M	5.2M	65.7M	65.4M	65.6M	0.0M	0.1M	0.1M
S-250814-00629_d7f1b318-d84d-4a76-b671-925e74e681c7	66.3M	66.3M	66.3M	0.1M	3.5M	66.2M	65.8M	66.2M	0.0M	0.1M	0.1M
S-250814-00732_62280390-e28d-4a64-97ee-d6a13f0fc280	94.1M	94.1M	94.0M	0.1M	8.5M	94.0M	93.1M	93.9M	0.0M	0.1M	0.1M
S-250819-00049_9b1d8272-0fcb-4f1f-9f04-6174c130027d	50.3M	50.3M	50.2M	0.1M	2.5M	50.2M	49.9M	50.2M	0.0M	0.1M	0.0M
S-250820-00433_10efaca3-fabc-4fc5-be4b-20f1a7603f89	83.0M	83.0M	82.9M	0.1M	7.0M	82.9M	82.3M	82.8M	0.0M	0.1M	0.1M
S-250820-00481_63364e56-8f5d-45b1-88ba-6502dbd98c8e	80.1M	80.1M	80.1M	0.1M	7.2M	80.1M	79.3M	80.0M	0.0M	0.1M	0.0M
S-250820-00482_49523f4b-a24f-460b-a50b-10a58a77eb0a	69.8M	69.8M	69.8M	0.1M	5.0M	69.7M	69.4M	69.7M	0.0M	0.1M	0.0M
S-250820-00483_45a4e3cb-72ac-4912-9d06-805c42b79a82	80.9M	80.9M	80.8M	0.1M	7.4M	80.8M	80.1M	80.7M	0.0M	0.1M	0.1M
S-250820-00484_a807be4b-5ac5-4163-b1a5-3fbf63b58cca	77.4M	77.4M	77.3M	0.1M	3.9M	77.3M	76.8M	77.2M	0.0M	0.1M	0.1M
S-250820-00485_eddf9666-e661-457a-b139-e1f03b690a07	71.7M	71.7M	71.7M	0.1M	4.6M	71.7M	71.3M	71.6M	0.0M	0.1M	0.1M
S-250820-00486_e5974009-5bff-44cd-9b0f-5db9dcc3cba8	69.1M	69.1M	69.0M	0.1M	4.3M	69.0M	68.5M	68.9M	0.0M	0.1M	0.0M
S-250822-00209_2dd76a00-a9a5-4703-b6ae-feb1d5b82ce2	81.1M	81.1M	81.0M	0.1M	6.0M	81.0M	80.5M	80.9M	0.0M	0.1M	0.1M
S-250822-00210_af636a80-a80d-4012-af84-ef8afe957595	60.8M	60.8M	60.8M	0.1M	3.4M	60.7M	60.4M	60.7M	0.0M	0.1M	0.0M
S-250822-00211_f789a847-cd56-4cfd-a4ec-c373f9bb5e23	63.1M	63.1M	63.0M	0.1M	4.0M	63.0M	62.7M	62.9M	0.0M	0.1M	0.0M
S-250822-00212_c1da616e-bd7e-4e6d-9a66-157b74cedcac	71.2M	71.2M	71.2M	0.1M	4.7M	71.1M	70.7M	71.1M	0.0M	0.1M	0.1M
S-250822-00213_d2ac3f81-dbcf-4c66-b1f3-1e4044e3397c	78.1M	78.1M	78.1M	0.1M	5.0M	78.0M	77.5M	78.0M	0.0M	0.1M	0.1M
S-250822-00214_4d86a88c-b94b-40c9-a2c2-758a9e4d5e25	74.5M	74.5M	74.5M	0.1M	4.5M	74.4M	74.0M	74.4M	0.0M	0.1M	0.1M
S-250822-00215_8dfb0694-a0ca-40c0-a211-8c17b3f4a5fc	64.6M	64.6M	64.6M	0.1M	4.2M	64.6M	64.2M	64.5M	0.0M	0.1M	0.0M
S-250822-00216_d0b4bec8-159f-4d5e-a1d1-1fc332a02c83	55.4M	55.4M	55.4M	0.1M	3.7M	55.4M	55.1M	55.3M	0.0M	0.1M	0.0M
S-250822-00217_49d2839c-4d06-4169-a788-97b27c304f62	51.6M	51.6M	51.6M	0.1M	2.8M	51.6M	51.3M	51.6M	0.0M	0.1M	0.0M
S-250822-00218_fc713823-ad3b-4a50-899a-81bce7b43d1f	55.7M	55.7M	55.7M	0.1M	3.1M	55.6M	55.4M	55.6M	0.0M	0.1M	0.0M
S-250822-00219_36b8edd5-fef8-41d4-a208-dbfbac3c9b09	62.8M	62.8M	62.8M	0.1M	3.9M	62.7M	62.3M	62.7M	0.0M	0.1M	0.0M
S-250822-00220_11f97cf7-03f1-4400-a3bb-46bc02340222	67.4M	67.4M	67.3M	0.1M	4.4M	67.3M	66.9M	67.2M	0.0M	0.1M	0.1M
S-250822-00221_1040936e-8f70-4aba-a77f-ca39d6001358	58.5M	58.5M	58.5M	0.1M	3.6M	58.4M	58.1M	58.4M	0.0M	0.1M	0.0M
S-250822-00222_4662c7ab-83c5-4609-9a2a-0ab9aa79fe4d	59.3M	59.3M	59.2M	0.1M	3.8M	59.2M	58.8M	59.1M	0.0M	0.1M	0.0M
S-250822-00223_240640c0-03aa-44a1-a3c4-54f4b78b6529	65.4M	65.4M	65.3M	0.1M	4.2M	65.3M	65.0M	65.2M	0.0M	0.1M	0.1M
S-250822-00224_950529bd-92d1-40fa-a2e1-11d6ec5fc8f7	69.0M	69.0M	69.0M	0.1M	3.7M	68.9M	68.5M	68.9M	0.0M	0.1M	0.1M
S-250822-00225_67a53117-78ab-411b-8f46-4e30f440fa90	52.7M	52.7M	52.6M	0.1M	2.7M	52.6M	52.3M	52.6M	0.0M	0.1M	0.0M
S-250822-00226_0ead66c4-62eb-4c8d-b539-b354b4d41341	60.3M	60.3M	60.3M	0.1M	2.8M	60.3M	60.0M	60.2M	0.0M	0.1M	0.0M
S-250822-00227_3c8dcbc9-4b61-45ef-87d9-02c196d7fa22	65.9M	65.9M	65.9M	0.1M	3.2M	65.8M	65.4M	65.8M	0.0M	0.1M	0.1M
S-250822-00228_77d5fe15-72df-4d26-8d8e-e7139ab594e7	99.0M	99.0M	99.0M	0.1M	7.2M	98.9M	98.2M	98.9M	0.0M	0.1M	0.1M
S-250822-00229_05422e5b-3fcf-4498-87b6-b33aa6ca1517	89.6M	89.6M	89.5M	0.1M	6.9M	89.4M	88.8M	89.4M	0.0M	0.1M	0.1M
S-250822-00230_7fee2a2e-ae47-4517-80ad-f54ae8a03935	42.3M	42.3M	42.2M	0.0M	3.1M	42.2M	42.0M	42.2M	0.0M	0.1M	0.0M
S-250822-00231_5b125551-2b57-40ad-be8a-91ed2cb2ed56	63.8M	63.8M	63.8M	0.1M	4.1M	63.7M	63.4M	63.7M	0.0M	0.1M	0.0M
S-250822-00232_f2803cde-bf7a-4ed8-b92c-55d94b9e8239	65.5M	65.5M	65.4M	0.1M	3.9M	65.4M	65.0M	65.3M	0.0M	0.1M	0.1M
S-250822-00233_92a22ba1-8019-49b6-b798-cc646424008b	52.7M	52.7M	52.7M	0.1M	2.6M	52.6M	52.4M	52.6M	0.0M	0.1M	0.0M
S-250822-00492_db4f6267-937e-424a-af7a-c8af307a146a	67.5M	67.5M	67.4M	0.1M	3.7M	67.4M	67.0M	67.3M	0.0M	0.1M	0.0M
S-250822-00494_fe7b99b5-71be-41b3-802e-0d949dec7e4e	62.8M	62.8M	62.8M	0.1M	3.3M	62.7M	62.4M	62.7M	0.0M	0.1M	0.0M
S-250822-00495_31040f17-7c34-4253-abe7-d140cdd41f38	82.2M	82.2M	82.2M	0.1M	7.1M	82.2M	81.7M	82.1M	0.0M	0.1M	0.1M
S-250822-00496_d3e4ce1b-d748-4047-926c-a988768d07ad	49.8M	49.8M	49.8M	0.1M	2.4M	49.7M	49.4M	49.7M	0.0M	0.1M	0.0M
S-250822-00497_04f97331-2f4f-4258-9514-f219f21e66fb	66.7M	66.7M	66.7M	0.1M	3.6M	66.6M	66.2M	66.6M	0.0M	0.1M	0.1M
S-250822-00498_625fc59a-f197-4378-a9ea-cc26b5b5ada1	62.1M	62.1M	62.1M	0.1M	3.1M	62.0M	61.7M	62.0M	0.0M	0.1M	0.1M
S-250822-00499_fae4e4bf-babe-45d6-80b1-fedf25da68cf	66.4M	66.4M	66.4M	0.1M	3.6M	66.3M	66.0M	66.3M	0.0M	0.1M	0.0M
S-250822-00500_460135da-8fe5-4870-a3d1-fc3385683709	63.1M	63.1M	63.1M	0.1M	3.7M	63.0M	62.7M	63.0M	0.0M	0.1M	0.0M
S-250822-00501_eb0ce672-e290-4dc8-86da-da0e81582343	62.5M	62.5M	62.5M	0.1M	4.8M	62.4M	62.0M	62.4M	0.0M	0.1M	0.0M
S-250822-00502_7c35d8ac-1773-4f27-b7c4-cae6108dcd75	58.5M	58.5M	58.5M	0.1M	3.2M	58.4M	58.1M	58.4M	0.0M	0.1M	0.0M
S-250822-00503_14f3a6b6-6c61-408c-b7a5-cc9374ad2bb1	55.6M	55.6M	55.6M	0.1M	3.6M	55.5M	55.3M	55.5M	0.0M	0.1M	0.0M
S-250822-00504_5b06c29d-f381-432a-a53f-eac5a97eb22c	52.9M	52.9M	52.9M	0.1M	2.6M	52.9M	52.6M	52.8M	0.0M	0.1M	0.0M
S-250822-00505_fe6a143b-1ded-4661-9d62-bb4ea23f6d81	79.8M	79.8M	79.7M	0.1M	6.4M	79.7M	79.2M	79.6M	0.0M	0.1M	0.0M
S-250822-00506_fcb844d3-58b4-4805-837d-893bbf64f560	68.2M	68.2M	68.1M	0.1M	4.6M	68.1M	67.7M	68.0M	0.0M	0.1M	0.0M
S-250822-00507_4f0c3fee-6955-4426-b410-8df0e29e8635	72.3M	72.3M	72.2M	0.1M	4.8M	72.2M	71.8M	72.1M	0.0M	0.1M	0.1M
S-250822-00508_5c6f7ef9-50a3-445e-8d0a-61066995373e	58.6M	58.6M	58.6M	0.1M	3.8M	58.6M	58.3M	58.5M	0.0M	0.1M	0.0M
S-250822-00872_ff04e58d-3061-4bb4-b306-f225c7386b9d	55.6M	55.6M	55.6M	0.1M	2.7M	55.6M	55.3M	55.5M	0.0M	0.1M	0.0M
S-250825-00001_d191a398-563a-4643-8895-9768746ccbe6	66.4M	66.4M	66.4M	0.1M	3.6M	66.3M	66.0M	66.3M	0.0M	0.1M	0.1M
S-250827-00660_67f1c844-90f0-45cb-8d21-05586839dbce	69.7M	69.7M	69.7M	0.1M	5.6M	69.6M	69.3M	69.6M	0.0M	0.1M	0.1M
S-250827-00667_2d886e3a-05ec-440d-ae76-046c89304896	56.6M	56.6M	56.6M	0.1M	3.6M	56.6M	56.3M	56.5M	0.0M	0.1M	0.0M
S-250827-00674_d1f9b133-592a-42c5-88d7-6464c212d58e	64.3M	64.3M	64.3M	0.1M	3.8M	64.2M	63.9M	64.2M	0.0M	0.1M	0.0M
S-250827-00681_75f7043d-7d14-46ef-9ef7-3ddcab771780	45.1M	45.1M	45.1M	0.1M	1.8M	45.0M	44.8M	45.0M	0.0M	0.1M	0.1M
S-250827-00688_74e73f4c-6c9f-4c19-89b9-2e619195e51a	71.0M	71.0M	71.0M	0.1M	5.1M	71.0M	70.6M	70.9M	0.0M	0.1M	0.0M
S-250827-00695_aedc1869-a08d-4986-93fa-8fef0f09c5e6	33.4M	33.4M	33.4M	0.1M	3.0M	33.3M	33.0M	33.3M	0.0M	0.1M	0.1M
S-250827-00702_995aea88-65e8-4f18-9fb1-c1a4a54e6e43	63.1M	63.1M	63.1M	0.1M	4.3M	63.0M	62.7M	63.0M	0.0M	0.1M	0.1M
S-250827-00709_a416d61d-5743-4997-bb66-00afbfd10957	66.8M	66.8M	66.7M	0.1M	3.0M	66.7M	66.3M	66.6M	0.0M	0.1M	0.1M
S-250827-00716_58befaa6-0add-4149-9e70-e4cc72f689f4	77.7M	77.7M	77.6M	0.1M	3.7M	77.6M	77.3M	77.5M	0.0M	0.1M	0.1M
S-250827-00723_699dd683-bacb-4baa-a16d-969a15a9f3c9	66.5M	66.5M	66.5M	0.1M	4.8M	66.4M	66.1M	66.4M	0.0M	0.1M	0.0M
S-250827-00730_cdb8bd18-8729-41b3-a9d8-3cbde32801f1	68.5M	68.5M	68.5M	0.1M	3.7M	68.4M	68.1M	68.4M	0.0M	0.1M	0.1M
S-250827-00737_5f2fb90a-f6b9-4882-835c-64bed0d3b7aa	47.3M	47.3M	47.2M	0.1M	2.5M	47.2M	46.9M	47.2M	0.0M	0.1M	0.0M
S-250827-00744_25253aa3-0561-4205-8381-20b167018313	53.6M	53.6M	53.6M	0.1M	4.5M	53.4M	53.2M	53.4M	0.0M	0.1M	0.1M
S-250827-00751_cd483f87-fc97-43f8-9aec-218fde814bf7	67.7M	67.7M	67.7M	0.1M	3.4M	67.6M	67.3M	67.6M	0.0M	0.1M	0.1M
S-250827-00758_f4dbf8e7-1283-4105-9c2e-341ab79dcb70	56.1M	56.1M	56.1M	0.1M	3.2M	56.1M	55.8M	56.0M	0.0M	0.1M	0.0M
S-250827-00765_5e780dc4-3bb8-4b99-8f7e-dd96120493f5	61.9M	61.9M	61.8M	0.1M	3.3M	61.7M	61.5M	61.7M	0.0M	0.1M	0.1M
S-250827-00772_c3a75258-9dcc-4364-be0c-5a5940aaa89a	54.7M	54.7M	54.7M	0.1M	3.6M	54.6M	54.3M	54.6M	0.0M	0.1M	0.1M
S-250827-00779_e2bd783f-69cf-471c-a8f0-cdafd8810f0f	42.1M	42.1M	42.0M	0.1M	3.1M	42.0M	41.8M	41.9M	0.0M	0.1M	0.0M
S-250827-01007_66438e3a-d7ca-43f6-a6f5-f313e65940dc	64.4M	64.4M	64.3M	0.1M	3.4M	64.3M	64.0M	64.2M	0.0M	0.1M	0.0M
S-250827-01012_880d529c-ab2e-46c6-96d0-3602fb8d4e37	60.2M	60.2M	60.2M	0.1M	4.1M	60.2M	59.9M	60.1M	0.0M	0.1M	0.0M
S-250827-01201_55e91561-d82b-4aee-869a-8ef4acb18c40	63.9M	63.9M	63.8M	0.1M	3.5M	63.8M	63.4M	63.8M	0.0M	0.1M	0.0M
S-250827-01310_f222f790-0605-4187-bc33-598ed9a17ae3	49.6M	49.6M	49.5M	0.1M	2.5M	49.5M	49.2M	49.5M	0.0M	0.1M	0.0M
S-250827-01323_265e592f-7cbc-4129-bef3-90677181307b	68.3M	68.3M	68.2M	0.1M	4.4M	68.2M	67.6M	68.2M	0.0M	0.1M	0.0M
S-250827-01330_a891878a-39cc-4d48-a396-c014d49d8a23	72.1M	72.1M	72.1M	0.1M	3.9M	72.0M	71.7M	72.0M	0.0M	0.1M	0.0M
S-250827-01337_039a23f4-7a0e-4d82-9fb8-b8427ed18779	59.5M	59.5M	59.5M	0.1M	4.2M	59.4M	59.1M	59.4M	0.0M	0.1M	0.0M
S-250827-01345_0e9b2346-2e96-4bd4-ac47-cc926ecac44f	57.4M	57.4M	57.4M	0.1M	3.4M	57.3M	57.1M	57.3M	0.0M	0.1M	0.1M
S-250827-01352_f7f1e473-9a23-40cb-8ead-6b5f119e8c84	75.2M	75.2M	75.2M	0.1M	3.8M	75.1M	74.7M	75.1M	0.0M	0.1M	0.1M
S-250827-01359_46449f60-2787-4286-83b8-65cc34fc6ffe	55.9M	55.9M	55.9M	0.1M	3.5M	55.8M	55.4M	55.8M	0.0M	0.1M	0.0M
S-250829-00121_f59bc54d-87ac-4f85-acc7-127a9a628ae3	63.1M	63.1M	63.1M	0.1M	4.1M	63.1M	62.7M	63.0M	0.0M	0.1M	0.0M
S-250829-00149_1540e264-eb7b-40c6-b75a-0dee7c73dc90	66.5M	66.5M	66.5M	0.1M	3.8M	66.4M	66.1M	66.4M	0.0M	0.1M	0.0M
S-250829-00274_f7232d3b-89fb-434b-aa77-cf8319ae0c37	60.7M	60.7M	60.6M	0.1M	2.7M	60.6M	60.2M	60.6M	0.0M	0.1M	0.0M
S-250829-00275_77ba91d6-95de-4402-bdc1-b1d4003a2c6e	59.9M	59.9M	59.9M	0.1M	4.1M	59.9M	59.6M	59.8M	0.0M	0.1M	0.0M
S-250829-00276_631e548a-e780-4d78-a422-87e3bd8ccc74	55.1M	55.1M	55.1M	0.1M	2.8M	55.1M	54.8M	55.0M	0.0M	0.1M	0.0M
S-250829-00277_da615cb9-fa8a-4de2-9f22-0cc4f4bd24ee	59.4M	59.4M	59.4M	0.1M	3.3M	59.3M	59.1M	59.3M	0.0M	0.1M	0.0M
S-250829-00278_f38805f9-2f9d-4bf4-904b-74d6b4c44a5a	45.9M	45.9M	45.9M	0.1M	2.7M	45.8M	45.6M	45.8M	0.0M	0.1M	0.1M
S-250829-00279_36ea5bb7-4c11-41d4-aacf-b6c999e095c6	43.1M	43.1M	43.1M	0.1M	2.1M	43.1M	42.8M	43.0M	0.0M	0.1M	0.1M
S-250829-00280_6129aed7-cb60-45cd-a640-654d3cadafcc	40.3M	40.3M	40.3M	0.1M	3.3M	40.2M	40.0M	40.2M	0.0M	0.1M	0.0M
S-250902-00424_a66c1e49-594e-4229-bf1f-96d8f5d1ec92	73.7M	73.7M	73.6M	0.2M	6.0M	73.5M	73.2M	73.5M	0.0M	0.2M	0.1M
S-250908-00005_516e6c1a-3dc6-46a8-af18-7574fe413c89	52.8M	52.8M	52.8M	0.1M	2.4M	52.7M	52.5M	52.7M	0.0M	0.1M	0.1M
S-250909-00166_707ebc4d-0e35-446f-a8b9-b5c7b932acec	56.8M	56.8M	56.8M	0.1M	2.8M	56.7M	56.4M	56.6M	0.0M	0.1M	0.1M
S-250909-00190_752b0c91-855f-4d9f-a2f5-3080c9600e6b	53.1M	53.1M	53.1M	0.1M	3.0M	53.0M	52.8M	53.0M	0.0M	0.1M	0.1M
S-250910-00496_cf867bc2-9b7a-4c9f-9ac3-00ff7a2ac77f	68.2M	68.2M	68.2M	0.1M	3.2M	68.1M	67.8M	68.1M	0.0M	0.1M	0.1M
S-250911-00326_9b456756-25c8-4580-a103-4dbf18a64bb6	39.8M	39.8M	39.8M	0.1M	2.6M	39.7M	39.5M	39.7M	0.0M	0.1M	0.0M
S-250911-00327_f267470d-4cce-4caa-8acb-2ebf4d8e3ea1	48.6M	48.6M	48.6M	0.1M	2.5M	48.5M	48.3M	48.5M	0.0M	0.1M	0.0M
S-250911-00328_e07e4878-98b1-4092-9801-15ab5daec151	49.4M	49.4M	49.4M	0.1M	2.6M	49.3M	49.0M	49.2M	0.0M	0.1M	0.1M
S-250911-00329_e3499bac-a9ea-4b00-a8c3-cb61b1cd0b76	53.0M	53.0M	53.0M	0.1M	3.2M	52.9M	52.7M	52.9M	0.0M	0.1M	0.1M
S-250911-00330_9874d58c-df05-448c-939e-93cb64a3cbea	42.3M	42.3M	42.3M	0.1M	2.4M	42.2M	42.0M	42.2M	0.0M	0.1M	0.0M
S-250911-00331_4ed2083c-51c6-417c-a6d1-e0d44ad9f22d	55.3M	55.3M	55.3M	0.1M	3.1M	55.2M	55.0M	55.2M	0.0M	0.1M	0.1M
S-250911-00332_f3195b50-3185-4f64-806a-0ec92b5a49ca	47.3M	47.3M	47.3M	0.1M	3.2M	47.2M	47.0M	47.2M	0.0M	0.1M	0.0M
S-250911-00333_38036a77-0995-4fef-b50a-9534fad64f6c	63.2M	63.2M	63.2M	0.1M	4.7M	63.1M	62.7M	63.0M	0.0M	0.1M	0.1M
S-250911-00334_4dbb50dd-0e36-4d2f-af29-5d6890ac7fe5	41.3M	41.3M	41.3M	0.1M	1.9M	41.2M	41.0M	41.2M	0.0M	0.1M	0.1M
S-250911-00335_d27e6575-ebb1-4aa3-a4d2-c0f2ebd69085	46.4M	46.4M	46.4M	0.1M	2.5M	46.3M	46.0M	46.3M	0.0M	0.1M	0.0M
S-250911-00336_daeca8d1-5f75-4872-a818-9166bab42b87	46.4M	46.4M	46.4M	0.1M	2.8M	46.3M	46.1M	46.3M	0.0M	0.1M	0.1M
S-250911-00337_4dc432f7-5979-4f14-b616-518bf11c2f94	49.9M	49.9M	49.9M	0.1M	3.0M	49.8M	49.5M	49.8M	0.0M	0.1M	0.1M
S-250911-00338_1ef16eb7-2088-4afe-93c2-da6a07e786dd	49.8M	49.8M	49.8M	0.1M	3.0M	49.7M	49.5M	49.7M	0.0M	0.1M	0.1M
S-250911-00339_341ef06b-33d3-488a-a96d-fa60dd281053	49.1M	49.1M	49.1M	0.1M	3.5M	48.9M	48.7M	48.9M	0.0M	0.1M	0.1M
S-250911-00340_20ba413d-9840-4581-adbe-125c7529482d	52.2M	52.2M	52.2M	0.1M	3.4M	52.1M	51.9M	52.1M	0.0M	0.1M	0.1M
S-250911-00341_35e73857-ba04-4c88-8339-81f2a748b407	53.9M	53.9M	53.8M	0.1M	3.8M	53.7M	53.4M	53.7M	0.0M	0.1M	0.1M
S-250911-00342_7f6c7680-37a2-4e0e-8296-7dcc652c21fb	56.3M	56.3M	56.3M	0.1M	4.6M	56.2M	55.9M	56.2M	0.0M	0.2M	0.1M
S-250911-00343_3863b041-712f-4e58-8ef1-453e483122dc	65.6M	65.6M	65.6M	0.1M	4.5M	65.5M	65.2M	65.5M	0.0M	0.1M	0.1M
S-250911-00344_1f662520-9581-42b7-aef7-6dc6f052bea5	73.2M	73.2M	73.2M	0.1M	3.6M	73.1M	72.7M	73.1M	0.0M	0.2M	0.1M
S-250911-00345_2395ec3f-b295-420e-8f5a-6769446d747c	51.0M	51.0M	51.0M	0.1M	2.9M	50.9M	50.7M	50.9M	0.0M	0.1M	0.1M
S-250911-00346_1b2a079e-9af2-4faf-8b4d-3e8936d89b8a	46.3M	46.3M	46.2M	0.1M	1.5M	46.1M	45.6M	46.1M	0.0M	0.1M	0.1M
S-250911-00347_245e635b-471b-4aaf-854c-cc5f158db645	48.4M	48.4M	48.4M	0.1M	2.7M	48.3M	48.0M	48.3M	0.0M	0.1M	0.1M
S-250911-01190_ef232f01-a960-43e3-995e-c43619107969	35.2M	35.2M	35.2M	0.1M	1.8M	35.2M	35.0M	35.2M	0.0M	0.1M	0.0M
S-250911-01197_b270fa73-dca7-431e-9b9f-1c77ce535d11	43.0M	43.0M	43.0M	0.1M	3.0M	42.9M	42.7M	42.9M	0.0M	0.1M	0.0M
S-250911-01205_d263982c-da91-435a-8ada-e458715070c9	43.4M	43.4M	43.4M	0.1M	2.8M	43.3M	43.1M	43.3M	0.0M	0.1M	0.0M
S-250911-01242_165e3da3-870a-49e3-9761-499e36ef451a	41.9M	41.9M	41.8M	0.1M	2.1M	41.8M	41.6M	41.8M	0.0M	0.1M	0.0M
S-250911-01249_76052503-4407-4310-81d6-ec1d064cf465	45.9M	45.9M	45.9M	0.1M	3.2M	45.8M	45.6M	45.8M	0.0M	0.1M	0.1M
S-250911-01282_f7d441c7-fd77-4d32-b98b-a0d3b6233565	52.9M	52.9M	52.9M	0.1M	3.8M	52.8M	52.5M	52.8M	0.0M	0.1M	0.1M
S-250911-01327_17c6d1c7-ac94-4e21-9ab5-debe7c428698	51.6M	51.6M	51.6M	0.1M	2.9M	51.5M	51.2M	51.4M	0.0M	0.1M	0.1M
S-250911-01376_e00fa09c-d84e-4318-a3a9-3f7f0606cccf	52.3M	52.3M	52.3M	0.1M	3.8M	52.2M	52.0M	52.2M	0.0M	0.1M	0.1M
S-250911-01390_69eeed35-ef3d-453e-a764-3a231815ba95	53.5M	53.5M	53.4M	0.1M	4.1M	53.3M	53.1M	53.3M	0.0M	0.1M	0.1M
S-250911-01404_5d1924a5-df15-41b5-a626-6c195218cbe5	52.1M	52.1M	52.1M	0.1M	2.8M	52.0M	51.8M	52.0M	0.0M	0.1M	0.1M
S-250911-01421_36f863c8-e7a2-49b4-b93f-49eb323db4a3	46.1M	46.1M	46.1M	0.1M	3.4M	46.0M	45.8M	46.0M	0.0M	0.1M	0.0M
S-250911-01428_b5ab2187-55a9-4898-a324-dc01c16bc152	50.7M	50.7M	50.7M	0.1M	2.6M	50.6M	50.3M	50.6M	0.0M	0.1M	0.1M
S-250911-01435_f1aea929-af7e-469f-aab8-a44bd2434b3c	55.7M	55.7M	55.7M	0.1M	3.3M	55.6M	55.4M	55.6M	0.0M	0.1M	0.1M
S-250911-01442_c5a7e314-5285-435f-8cfd-7f8919de7b2b	46.9M	46.9M	46.9M	0.1M	2.3M	46.8M	46.6M	46.8M	0.0M	0.1M	0.1M
S-250911-01450_c3194475-9e2c-4a22-99f7-454e4d3431fa	57.5M	57.5M	57.5M	0.1M	3.9M	57.4M	57.1M	57.4M	0.0M	0.1M	0.0M
S-250911-01458_6f9eec2f-6991-43e6-bcb9-774ca5fc71ee	50.4M	50.4M	50.4M	0.1M	3.3M	50.3M	50.0M	50.2M	0.0M	0.1M	0.1M
S-250911-01554_384fe33c-32e3-46df-962c-b41deda2fa4c	55.6M	55.6M	55.6M	0.1M	3.3M	55.5M	55.2M	55.5M	0.0M	0.2M	0.1M
S-250911-01649_4f0c43d7-a838-4a46-9b87-1078c2f881c3	49.4M	49.4M	49.3M	0.1M	3.4M	49.2M	49.0M	49.2M	0.0M	0.1M	0.1M
S-250911-01656_4be176a0-2efc-4bad-93e5-824857aac632	61.1M	61.1M	61.1M	0.1M	3.7M	61.0M	60.7M	60.9M	0.0M	0.2M	0.1M
S-250911-01663_0feb6d72-04c3-41c5-9d2d-39b7d0ed0ef0	56.8M	56.8M	56.8M	0.1M	3.2M	56.7M	56.5M	56.7M	0.0M	0.1M	0.1M
S-250911-01670_cb660229-4826-4ccd-894c-10895fcecd53	53.9M	53.9M	53.9M	0.1M	3.9M	53.8M	53.5M	53.7M	0.0M	0.1M	0.1M
S-250911-01678_28218baa-c34d-4d1c-a024-b49b66c2bf70	49.0M	49.0M	49.0M	0.1M	2.4M	48.9M	48.7M	48.9M	0.0M	0.1M	0.1M
S-250911-01685_ae766c59-667b-49d1-aeef-a67887f80169	62.6M	62.6M	62.6M	0.1M	4.3M	62.5M	62.2M	62.5M	0.0M	0.1M	0.1M
S-250911-01698_7953357e-7c9e-4c50-99b1-653fc8c5a666	57.3M	57.3M	57.3M	0.1M	4.2M	57.1M	56.9M	57.1M	0.0M	0.1M	0.1M
S-250911-01781_78f21026-8c68-4f77-97e2-432af0a635f3	50.8M	50.8M	50.8M	0.1M	3.0M	50.7M	50.5M	50.7M	0.0M	0.1M	0.1M
S-250911-01792_1813488e-8dd7-4e4a-a4b7-7dfa2f8f970b	56.0M	56.0M	56.0M	0.1M	3.9M	55.8M	55.6M	55.8M	0.0M	0.1M	0.1M
S-250911-01801_17d1ffc3-90fb-4c7d-90b7-a6c8a9bc65a7	68.7M	68.7M	68.7M	0.1M	3.8M	68.6M	68.3M	68.6M	0.0M	0.1M	0.1M
S-250911-01808_2922ccf1-c978-4f1c-83af-c05d16efc338	53.0M	53.0M	53.0M	0.1M	3.0M	52.9M	52.7M	52.9M	0.0M	0.1M	0.1M
S-250911-01815_dc4701c7-3121-4d2c-9e5c-1cb5ffda3198	53.2M	53.2M	53.2M	0.1M	3.6M	53.1M	52.8M	53.1M	0.0M	0.1M	0.1M
S-250911-01822_440f0e3a-8d50-4ef5-9cde-f3fe966ad752	31.2M	31.2M	31.2M	0.1M	1.4M	31.1M	30.9M	31.1M	0.0M	0.1M	0.0M
S-250911-01840_dd8c9bd8-8ea7-485a-887e-fc289fe5b3a6	48.5M	48.5M	48.5M	0.1M	3.1M	48.4M	48.2M	48.4M	0.0M	0.1M	0.1M
S-250911-01847_74c130aa-4a2c-45cb-8ba4-9374fa072cd6	46.4M	46.4M	46.3M	0.1M	3.1M	46.3M	46.0M	46.2M	0.0M	0.1M	0.1M
S-250911-01876_50626fab-3e63-4b9b-8acf-a055692f7418	53.7M	53.7M	53.7M	0.1M	3.7M	53.6M	53.3M	53.5M	0.0M	0.1M	0.1M
S-250911-01883_599437b2-67a1-4f84-ac2d-c09a64c2201c	46.5M	46.5M	46.5M	0.1M	2.9M	46.4M	46.1M	46.3M	0.0M	0.1M	0.1M
S-250911-01890_2395bcac-ab58-4af1-995e-30a9e7010893	57.9M	57.9M	57.9M	0.1M	3.5M	57.8M	57.5M	57.7M	0.0M	0.1M	0.1M
S-250911-01903_d9447f37-f45e-4ea0-82ef-da557ea0711a	50.6M	50.6M	50.6M	0.1M	4.2M	50.5M	50.3M	50.5M	0.0M	0.1M	0.0M
S-250911-01904_502feeac-e3ef-4617-b3de-8e69321f6bce	46.7M	46.7M	46.7M	0.1M	3.9M	46.6M	46.4M	46.6M	0.0M	0.1M	0.0M
S-250911-01911_33fea3f2-9159-47f5-9aba-ea70b1f0abc4	49.9M	49.9M	49.9M	0.1M	3.8M	49.8M	49.6M	49.8M	0.0M	0.1M	0.0M
S-250911-01918_d285ad43-4569-412b-b8c0-f651c2f10146	35.8M	35.8M	35.8M	0.1M	1.9M	35.7M	35.5M	35.7M	0.0M	0.1M	0.0M
S-250911-01925_e40ac63e-daed-45cb-9be1-0466f0dffec0	56.0M	56.0M	55.9M	0.1M	5.9M	55.8M	55.4M	55.8M	0.0M	0.1M	0.1M
S-250911-01933_23b3ed5e-2623-4f38-a718-d80400372648	57.6M	57.6M	57.6M	0.2M	5.1M	57.4M	57.1M	57.4M	0.0M	0.2M	0.1M
S-250911-01968_6a1942d9-e252-4408-8554-5813bc907e03	29.2M	29.2M	29.2M	0.1M	1.9M	29.2M	29.1M	29.2M	0.0M	0.1M	0.0M
S-250911-02235_d260d3f4-4417-4d7b-9a54-02460ca89ba5	48.3M	48.3M	48.3M	0.1M	2.3M	48.2M	47.9M	48.2M	0.0M	0.1M	0.1M
S-250911-02256_7187b781-5f06-4394-9830-d826082fc638	63.5M	63.5M	63.5M	0.1M	4.7M	63.4M	63.1M	63.4M	0.0M	0.1M	0.1M
S-250911-02271_45913be2-e3a0-4dcc-a656-d42f48441d56	57.0M	57.0M	57.0M	0.1M	2.8M	56.9M	56.7M	56.9M	0.0M	0.1M	0.1M
S-250911-02295_54896c3c-ff6c-4f89-a50e-cbf97879b7f4	58.3M	58.3M	58.3M	0.1M	3.6M	58.2M	57.9M	58.2M	0.0M	0.2M	0.1M
S-250911-02305_f54cf07b-98ac-4233-83a8-5c3b073c393b	58.8M	58.8M	58.8M	0.1M	4.0M	58.7M	58.4M	58.7M	0.0M	0.1M	0.1M
S-250911-02312_25dc639d-1a91-439d-8399-2aea4835741f	57.0M	57.0M	57.0M	0.1M	4.0M	56.9M	56.6M	56.9M	0.0M	0.1M	0.1M
S-250911-02319_86ff5a41-aafd-46be-8ad1-e5c392981acb	57.7M	57.7M	57.7M	0.1M	3.5M	57.6M	57.4M	57.6M	0.0M	0.1M	0.1M
S-250911-02326_9e5610c7-0b55-456d-8930-ba9fb7a06063	65.3M	65.3M	65.3M	0.2M	4.5M	65.1M	64.8M	65.1M	0.0M	0.2M	0.1M
S-250911-02340_1c18c484-d9e2-4036-a978-95568a5c4bb9	44.7M	44.7M	44.7M	0.1M	1.8M	44.7M	44.5M	44.6M	0.0M	0.1M	0.0M
S-250911-02348_a41ceded-9c02-4dec-94f5-c3999a1a3090	53.7M	53.7M	53.6M	0.1M	2.9M	53.5M	53.3M	53.5M	0.0M	0.1M	0.1M
S-250911-02355_8fd6e54c-b2bd-45e5-a02d-ce6d93b9d963	54.6M	54.6M	54.6M	0.1M	3.3M	54.5M	54.2M	54.4M	0.0M	0.1M	0.1M
S-250911-02362_24097176-d87d-4610-b45c-69a6ad568922	51.8M	51.8M	51.8M	0.1M	3.1M	51.7M	51.5M	51.7M	0.0M	0.1M	0.1M
S-250911-02384_5c29a978-a545-46d2-972f-1befbdf421e1	51.6M	51.6M	51.6M	0.1M	2.5M	51.6M	51.3M	51.5M	0.0M	0.1M	0.0M
S-250911-02392_54521ea1-7209-47ef-9383-9fe7d85ba90e	45.6M	45.6M	45.6M	0.1M	2.2M	45.5M	45.3M	45.5M	0.0M	0.1M	0.0M
S-250911-02393_91de935f-df63-4390-bad3-0e994db18e00	56.5M	56.5M	56.5M	0.1M	3.5M	56.4M	56.1M	56.4M	0.0M	0.1M	0.1M
S-250915-02746_0819225d-a1c6-476a-8ee5-946d915548e8	29.1M	29.1M	29.1M	0.1M	2.1M	29.1M	28.9M	29.1M	0.0M	0.1M	0.0M
S-250915-02958_25612c12-25ee-4268-8a10-b2e381b277d1	28.3M	28.3M	28.3M	0.1M	2.0M	28.3M	28.2M	28.3M	0.0M	0.1M	0.0M
S-250915-03181_d7ff49ee-fb0d-4049-89f4-d3dd014f6454	49.7M	49.7M	49.7M	0.1M	2.2M	49.6M	49.3M	49.5M	0.0M	0.1M	0.1M
S-250915-03227_537c8c90-4e44-4a86-b3ec-8de8881e0981	50.6M	50.6M	50.6M	0.1M	3.0M	50.5M	50.3M	50.5M	0.0M	0.1M	0.1M
S-250915-03241_d69f7256-a1f7-42d3-9128-638155f5ffc1	34.5M	34.5M	34.5M	0.1M	2.5M	34.4M	34.3M	34.4M	0.0M	0.1M	0.0M
S-250915-03248_c64dc66d-9fc2-4955-955f-39513e8e2792	32.3M	32.3M	32.3M	0.1M	2.3M	32.3M	32.1M	32.3M	0.0M	0.1M	0.0M
S-250915-03555_8ab1c789-3606-4b9e-a873-c4bad740eb6b	32.5M	32.5M	32.5M	0.1M	2.1M	32.5M	32.3M	32.5M	0.0M	0.1M	0.0M
S-250915-03570_e430cba4-4dc5-4bc3-9003-da8a90b660aa	27.9M	27.9M	27.9M	0.1M	1.9M	27.9M	27.8M	27.9M	0.0M	0.1M	0.0M
S-250922-00768_109f57ea-f77d-445b-bca5-41f549f247a4	28.5M	28.5M	28.5M	0.1M	1.6M	28.5M	28.3M	28.4M	0.0M	0.1M	0.0M
S-250922-01023_92271428-ee07-4489-a2c3-824c3a9c0dd1	29.5M	29.5M	29.5M	0.1M	2.2M	29.4M	29.2M	29.4M	0.0M	0.1M	0.0M
S-250922-01030_f8289268-c00f-421c-9b36-d9607233de00	28.4M	28.4M	28.4M	0.1M	2.5M	28.3M	28.2M	28.3M	0.0M	0.1M	0.0M
S-250922-01044_cb39c382-47ed-4388-8544-1dbea5387b83	29.3M	29.3M	29.3M	0.1M	2.0M	29.2M	29.1M	29.2M	0.0M	0.1M	0.0M
S-250922-01190_257c3947-a4e9-4532-871a-090aa988c058	28.0M	28.0M	28.0M	0.1M	2.8M	28.0M	27.8M	27.9M	0.0M	0.1M	0.0M
S-250922-01232_0377dad3-982d-4678-a846-efe9db9a0bc7	29.6M	29.6M	29.6M	0.1M	1.6M	29.5M	29.4M	29.5M	0.0M	0.1M	0.0M
S-250922-01240_27d8ef1a-42c8-4f4a-a068-4999c21a9cfa	29.3M	29.3M	29.3M	0.1M	2.6M	29.2M	29.1M	29.2M	0.0M	0.1M	0.0M
S-250922-01455_c384ac8c-f1c4-4bb0-8ba2-2df1634375e0	28.2M	28.2M	28.2M	0.1M	2.4M	28.1M	27.9M	28.1M	0.0M	0.1M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-table_table

Sort	Column	Description	ID	Scale
\|\|	Total Reads	Total Reads	`flagstat_total`	read_count
\|\|	Total Passed QC	Total Passed QC	`total_passed`	read_count
\|\|	Mapped	Mapped	`mapped_passed`	read_count
\|\|	Supplementary Alignments	Supplementary Alignments	`supplementary_passed`	read_count
\|\|	Duplicates	Duplicates	`duplicates_passed`	read_count
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed`	read_count
\|\|	Properly Paired	Properly Paired	`properly_paired_passed`	read_count
\|\|	Self and mate mapped	Reads with itself and mate mapped	`with_itself_and_mate_mapped_passed`	read_count
\|\|	Singletons	Singletons	`singletons_passed`	read_count
\|\|	Mate mapped to diff chr	Mate mapped to different chromosome	`with_mate_mapped_to_a_different_chr_passed`	read_count
\|\|	Diff chr (mapQ >= 5)	Mate mapped to different chromosome (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed`	read_count

Flagstat: Percentage of total

This module parses the output from samtools flagstat

Created with MultiQC

Showing ³⁴⁴/₃₄₄ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Supplementary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
S-250505-00334_5c9da34f-036a-43a9-b672-bc063fee78e0	100.0%	100.0%	99.9%	0.2%	3.9%	99.8%	99.5%	99.8%	0.0%	0.1%	0.0%
S-250505-00686_d84aaaf9-a498-4323-8bbe-db0989b1a03e	100.0%	100.0%	100.0%	0.2%	6.5%	99.8%	99.2%	99.8%	0.0%	0.3%	0.1%
S-250505-00689_4bb6333b-66f5-4b5a-9d2b-2319c515a93e	100.0%	100.0%	100.0%	0.2%	5.7%	99.8%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250519-00843_ef87e2f7-b7a4-4d95-b2d6-672c06e68943	100.0%	100.0%	100.0%	0.2%	4.8%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250603-01361_150c3496-e4a0-4944-bb82-78b699ec9d35	100.0%	100.0%	100.0%	0.3%	6.1%	99.7%	99.1%	99.7%	0.0%	0.3%	0.1%
S-250603-01362_e782ed11-b623-4fc6-8934-264b4011654f	100.0%	100.0%	100.0%	0.3%	6.6%	99.7%	99.1%	99.7%	0.0%	0.2%	0.1%
S-250603-01364_23781353-bebb-4338-935a-1c5934c79b4a	100.0%	100.0%	100.0%	0.3%	5.9%	99.7%	99.1%	99.7%	0.0%	0.3%	0.2%
S-250603-01368_ee8367a0-4f63-4a3f-9d47-881c3b97b97e	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250603-01369_6fcd990f-b370-41d4-b056-4b4433695684	100.0%	100.0%	100.0%	0.3%	6.2%	99.7%	99.0%	99.7%	0.0%	0.4%	0.2%
S-250603-01374_743e9e90-5e1b-49d9-b31c-ef674a145816	100.0%	100.0%	100.0%	0.2%	5.5%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250603-01375_cfd6f9a1-dd97-4041-bc56-46cfd2412cc8	100.0%	100.0%	100.0%	0.3%	8.5%	99.7%	99.0%	99.7%	0.0%	0.3%	0.1%
S-250603-01377_58cea1ec-460e-4c8b-8efe-5c1de181ea9e	100.0%	100.0%	100.0%	0.2%	6.7%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250603-01378_0744a261-c2c2-49b8-b09f-9d5a942348af	100.0%	100.0%	100.0%	0.3%	6.7%	99.7%	99.1%	99.7%	0.0%	0.3%	0.2%
S-250603-01379_05588894-b095-41c6-adc6-1b8db67e91c7	100.0%	100.0%	100.0%	0.3%	5.7%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250603-01380_df114a85-750a-42d8-859f-9bfdd6ae6029	100.0%	100.0%	100.0%	0.2%	4.0%	99.8%	99.1%	99.7%	0.0%	0.4%	0.2%
S-250603-01381_560359a6-e046-400e-b62e-3202865ae420	100.0%	100.0%	100.0%	0.2%	5.5%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250603-01385_4914b3de-1c91-47d9-9019-a854ea9e2abd	100.0%	100.0%	100.0%	0.2%	5.2%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250603-01387_730c7029-1b8c-44c8-920d-8553c08ef4f8	100.0%	100.0%	100.0%	0.2%	5.2%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250603-01388_65255e65-e0e9-4bcb-910d-daabbd8e6eab	100.0%	100.0%	100.0%	0.1%	7.4%	99.9%	99.1%	99.8%	0.0%	0.1%	0.1%
S-250603-01398_9bbbd46d-6098-429d-bc9a-8d310c6cc1c6	100.0%	100.0%	100.0%	0.2%	7.3%	99.8%	99.3%	99.7%	0.0%	0.3%	0.1%
S-250603-01402_5dad63d1-d394-4b5e-8820-d94d52032e8f	100.0%	100.0%	100.0%	0.2%	5.6%	99.8%	99.2%	99.8%	0.0%	0.2%	0.1%
S-250603-01404_e118daaf-9ef8-4d59-b50d-4821e8940e2a	100.0%	100.0%	100.0%	0.2%	4.6%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250605-00261_69f05be1-5bb5-4765-be27-f53a02a4746f	100.0%	100.0%	100.0%	0.3%	7.5%	99.7%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250606-00019_bd855797-f48b-4624-9388-1a5db76d86e7	100.0%	100.0%	100.0%	0.2%	4.8%	99.8%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250606-00024_9d811cd5-88ab-412e-be4a-693f251229b9	100.0%	100.0%	100.0%	0.2%	4.6%	99.8%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250606-00039_60503236-1e0a-4d97-b448-9082443a61ad	100.0%	100.0%	100.0%	0.2%	6.4%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250606-00442_5f352b85-74a6-4ba3-ac49-a59addba694f	100.0%	100.0%	100.0%	0.3%	8.4%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250609-00565_980c9761-0937-414a-9b2e-093857e777d1	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.4%	99.7%	0.0%	0.2%	0.1%
S-250609-00570_af1dce7b-22e5-4244-bd0c-8cd28a45aed4	100.0%	100.0%	100.0%	0.2%	7.3%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250613-00111_fe739b0a-b570-4f79-a669-4b4a81b0d2b1	100.0%	100.0%	100.0%	0.2%	4.5%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250613-00114_a42729e4-4231-4eac-8a16-fc64f6f4299f	100.0%	100.0%	100.0%	0.2%	5.1%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250613-00115_c9e094ba-7306-4b93-97e3-fb91a46fb45e	100.0%	100.0%	100.0%	0.2%	5.5%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250613-00116_c8f8f7f3-bce6-4336-9f03-dbe4c18a0dd7	100.0%	100.0%	100.0%	0.2%	5.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250613-00117_cc3aa885-09f9-4204-a9aa-ada9ad933479	100.0%	100.0%	100.0%	0.2%	7.1%	99.8%	99.5%	99.8%	0.0%	0.1%	0.1%
S-250613-00119_db2c162c-e73c-4087-a2a4-ec3ed37723cd	100.0%	100.0%	100.0%	0.2%	5.8%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250613-00120_3a58994d-ef86-4bf8-a2b3-1382ab96b228	100.0%	100.0%	100.0%	0.3%	7.0%	99.7%	99.0%	99.7%	0.0%	0.4%	0.2%
S-250616-00311_75a9c348-6dad-41b3-9ff8-87ddbd5de317	100.0%	100.0%	100.0%	0.2%	5.2%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250616-00494_e93c48db-efe4-4277-a400-e2dc578bf8cb	100.0%	100.0%	100.0%	0.3%	5.4%	99.7%	99.1%	99.7%	0.0%	0.4%	0.2%
S-250616-00639_8b5b43fb-b764-48e6-b945-7054bf098773	100.0%	100.0%	100.0%	0.2%	5.8%	99.8%	99.1%	99.7%	0.0%	0.3%	0.2%
S-250616-00785_2347484d-3245-49a3-a7af-afc5d4d263f6	100.0%	100.0%	100.0%	0.2%	7.7%	99.8%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250616-00786_79130f59-77d4-4335-a0a0-347fe3ee9551	100.0%	100.0%	100.0%	0.2%	5.4%	99.8%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250616-00788_fd46cf13-cc10-42f1-9f06-adbbe2d9c346	100.0%	100.0%	100.0%	0.2%	7.1%	99.8%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250616-00789_0faab632-c156-488f-a770-df34280733b0	100.0%	100.0%	100.0%	0.2%	6.4%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250616-00791_bc88f175-5a6f-4751-afe7-f8909776330d	100.0%	100.0%	100.0%	0.2%	4.3%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250616-00793_3487f1e4-af75-4b64-b56f-b526f92798fb	100.0%	100.0%	100.0%	0.2%	6.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250616-00795_9165584c-eec4-44a6-b0d5-a9fadc9a4ee9	100.0%	100.0%	100.0%	0.3%	7.3%	99.7%	99.1%	99.7%	0.0%	0.3%	0.2%
S-250616-00797_11c11567-6613-4baf-af92-c37b00f1680f	100.0%	100.0%	100.0%	0.2%	5.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250616-00798_4a5aa79d-8081-4a27-ba56-3c6222c41da6	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250617-00285_932db5da-af05-4885-897c-2a800b7c44ae	100.0%	100.0%	100.0%	0.3%	8.1%	99.7%	99.0%	99.7%	0.0%	0.3%	0.2%
S-250617-02155_44f6a14d-4927-4e7c-9d81-8c38e0db4dc2	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250618-01279_23b62d5d-54e8-444b-b3b5-3d551373d080	100.0%	100.0%	100.0%	0.2%	5.2%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250618-01293_2fdbb754-32af-4e80-8ca4-c6e20cd423d3	100.0%	100.0%	100.0%	0.2%	6.6%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250618-01294_189eb4c4-76d2-4219-9640-b05ab29a97d8	100.0%	100.0%	100.0%	0.2%	7.2%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250618-01295_8025e1c3-3271-4600-8a27-f9c815fd72d3	100.0%	100.0%	100.0%	0.2%	7.4%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250619-01389_49da55c5-9b79-4dc6-8a05-a7a9811d0176	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.1%	99.8%	0.0%	0.3%	0.1%
S-250623-00667_beb9f515-1306-491a-a9a7-462f808f7fe1	100.0%	100.0%	100.0%	0.2%	7.6%	99.8%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250623-00668_a7e8022e-76e1-499d-be0f-5221c3101510	100.0%	100.0%	100.0%	0.2%	6.5%	99.8%	99.2%	99.8%	0.0%	0.2%	0.1%
S-250623-00669_674129f1-6d9a-4a24-8f11-b65712e9afa9	100.0%	100.0%	100.0%	0.3%	6.8%	99.7%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250623-00670_3825b221-fd4d-4225-a02f-b901c2c29b7e	100.0%	100.0%	100.0%	0.2%	5.4%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250623-00672_463927f8-1553-4a21-af11-5e78f42cf58b	100.0%	100.0%	100.0%	0.3%	5.7%	99.7%	99.1%	99.7%	0.0%	0.3%	0.2%
S-250623-00673_7df3b641-922c-4692-be76-22299fd5d983	100.0%	100.0%	100.0%	0.2%	5.9%	99.8%	99.1%	99.7%	0.0%	0.3%	0.1%
S-250623-00674_69eb75d6-60e8-4698-a9e5-b7d2f480a261	100.0%	100.0%	100.0%	0.2%	5.8%	99.8%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250623-00676_915137fd-8e03-448f-a7c2-3804f911ffa9	100.0%	100.0%	100.0%	0.2%	6.3%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250623-00679_c5b2a0f9-25cf-4279-af2e-5aa637fe780f	100.0%	100.0%	100.0%	0.3%	7.0%	99.7%	99.1%	99.7%	0.0%	0.3%	0.1%
S-250623-00680_f7c88670-d59b-4693-97c7-88a5070e39d9	100.0%	100.0%	100.0%	0.3%	6.9%	99.7%	99.1%	99.7%	0.0%	0.3%	0.2%
S-250623-00682_f77b11b5-f09c-4be6-969a-9a9ce2ecbb17	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.2%	99.8%	0.0%	0.2%	0.1%
S-250623-00686_c60ee5bb-a36b-4e08-ac8f-ef222eee58fc	100.0%	100.0%	100.0%	0.3%	4.9%	99.7%	99.1%	99.7%	0.0%	0.3%	0.2%
S-250623-00687_0663013e-d536-4261-98ae-91dd99ef2550	100.0%	100.0%	100.0%	0.2%	5.7%	99.8%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250624-00049_593382fc-2a6f-4c93-b09c-6147d663a417	100.0%	100.0%	100.0%	0.3%	8.1%	99.7%	98.8%	99.7%	0.0%	0.3%	0.2%
S-250624-00523_a56fce7e-90a4-4e2c-a7f7-24a153d6bd6c	100.0%	100.0%	100.0%	0.2%	5.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250625-00890_dd602a38-afcf-44de-97fa-09e0cbeb6ee1	100.0%	100.0%	100.0%	0.2%	6.4%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250626-00449_a49ab0e5-3781-42a5-81d4-a3bfc13e0d06	100.0%	100.0%	100.0%	0.2%	7.2%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250626-00583_2477da27-4a71-41cc-932a-ffc477fea424	100.0%	100.0%	100.0%	0.2%	6.5%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250626-00839_54b0d9a3-458a-4c9d-8416-71372d16416b	100.0%	100.0%	100.0%	0.3%	9.1%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250627-00861_b4aa27da-fd30-49d3-a5fd-b2ff3913468d	100.0%	100.0%	100.0%	0.2%	6.9%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250627-00911_a4722dbd-a9dc-4489-9153-bf196b9e2276	100.0%	100.0%	100.0%	0.2%	6.4%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250630-00532_bb72f0f6-4428-4bbc-9fb1-0ef9f9d3d586	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250701-00032_2d03b23b-ec60-4778-bc7b-f8019bf2553b	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250701-00046_30643e3a-7f4d-4475-ac28-bf2a5b37a740	100.0%	100.0%	100.0%	0.2%	7.2%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250701-00084_bc231909-d837-42c4-b65a-7d4b1f5bb7be	100.0%	100.0%	100.0%	0.3%	8.2%	99.7%	99.1%	99.7%	0.0%	0.3%	0.2%
S-250701-00109_29722f82-b8a8-41eb-9c53-dee23832727e	100.0%	100.0%	100.0%	0.2%	5.1%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250701-00110_9e62f2ee-b15b-488d-b871-7503a54a3b3a	100.0%	100.0%	100.0%	0.2%	5.5%	99.8%	99.2%	99.8%	0.0%	0.3%	0.2%
S-250701-00112_cc86b201-4f3b-4b72-b25b-741eecdebdd8	100.0%	100.0%	100.0%	0.2%	6.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250701-00113_5d875162-c138-4eda-a83a-9bd2c064cd85	100.0%	100.0%	100.0%	0.2%	6.4%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250701-00114_522c4df3-cc89-4715-a4ae-af9ad9e8627b	100.0%	100.0%	100.0%	0.2%	8.3%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250701-00115_51e0667d-5371-4e5e-be13-87c770743ee5	100.0%	100.0%	100.0%	0.2%	7.0%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250701-00116_6c6f9b82-63da-4844-8d3c-ce0b08dd459b	100.0%	100.0%	100.0%	0.2%	5.8%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250701-00117_d2d09879-8c3f-46e5-bcad-3103311aab27	100.0%	100.0%	100.0%	0.2%	3.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250701-00118_9607b90c-15fc-4b2e-9d88-d325c219dbeb	100.0%	100.0%	100.0%	0.2%	5.0%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250701-00119_6b0bc8c3-e0e7-4c8e-a1b3-a75c7a8ee833	100.0%	100.0%	100.0%	0.2%	5.2%	99.8%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250701-00120_3e6e8956-1ecb-421e-be7a-c00c59b4b6c9	100.0%	100.0%	100.0%	0.3%	8.3%	99.7%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250701-00790_ee9540a9-68dc-4c7f-996f-416bc33900a0	100.0%	100.0%	100.0%	0.2%	5.4%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250702-00132_df7e18ea-a71e-43fc-bcd0-08adf555e889	100.0%	100.0%	100.0%	0.2%	6.5%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250702-00140_0e297b6c-2652-4809-bdff-40c4928700d9	100.0%	100.0%	100.0%	0.2%	5.7%	99.8%	99.3%	99.7%	0.0%	0.3%	0.1%
S-250702-01152_b7027206-8ef6-457c-93cc-2500864af55d	100.0%	100.0%	100.0%	0.2%	5.1%	99.8%	99.3%	99.7%	0.0%	0.3%	0.1%
S-250702-01169_ed26ee63-0e93-49fb-a3f2-904d50b21de1	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250702-01252_6a6c1bda-0256-445e-85f7-c45b7d60cac8	100.0%	100.0%	100.0%	0.2%	7.8%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250702-01259_2eb2b5a5-c93c-4c57-b0e8-c2ba1bfbdffb	100.0%	100.0%	100.0%	0.2%	6.4%	99.8%	99.3%	99.7%	0.0%	0.3%	0.1%
S-250702-01266_222878b9-2e84-4aea-a631-5fd9b8290a1a	100.0%	100.0%	100.0%	0.3%	8.4%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250702-01290_8877914b-e0ff-4c28-a293-bab12dfdf683	100.0%	100.0%	100.0%	0.2%	7.6%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250702-01308_c73b5d9b-ee41-4233-89c8-6e323f0f70a2	100.0%	100.0%	100.0%	0.2%	6.9%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250707-01209_5a970f5d-d29a-4595-a737-de80b6a13a7b	100.0%	100.0%	100.0%	0.2%	7.4%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250707-01210_e2cbd346-e8f8-4273-88a5-555243c66ec4	100.0%	100.0%	100.0%	0.2%	4.7%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250707-01211_b42d1d36-e4cc-4e18-90eb-ccb3d6a0002b	100.0%	100.0%	100.0%	0.2%	3.9%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250707-01212_e4387eff-e432-4cc8-85ed-68690667cb1b	100.0%	100.0%	100.0%	0.2%	6.7%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250707-01213_7f698bde-0e62-4e9b-aefe-caef0a7eed1c	100.0%	100.0%	100.0%	0.2%	6.4%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250707-01214_b3212505-b986-4b67-94aa-55303b7a01fe	100.0%	100.0%	100.0%	0.3%	6.9%	99.7%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250707-01215_8f4f29fb-8001-4183-9ec9-7e698ac91af8	100.0%	100.0%	100.0%	0.2%	5.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250707-01216_0c1dc0fc-d8e9-41cb-af77-f917f8e295c8	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.3%	99.7%	0.0%	0.3%	0.1%
S-250707-01218_5712d6f2-842e-4f36-aa6e-456677a01966	100.0%	100.0%	100.0%	0.2%	5.6%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250707-01219_4993e89c-8055-4595-8e81-1863b9592bfd	100.0%	100.0%	100.0%	0.2%	4.8%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250707-01220_03152d49-8ca3-412d-8fd4-4b11be585047	100.0%	100.0%	100.0%	0.2%	5.9%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250707-01221_cc2bda86-6ae3-41bf-931f-924062266f09	100.0%	100.0%	100.0%	0.2%	7.3%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250707-01222_9448d7ab-4770-4f78-9ee1-732a41e1cbbe	100.0%	100.0%	100.0%	0.2%	7.5%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250707-01223_67115096-73cc-4e71-8f77-fca5a886e436	100.0%	100.0%	100.0%	0.2%	7.4%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250707-01224_9cb1393c-93ea-4161-af22-8fe0fe420a84	100.0%	100.0%	100.0%	0.2%	7.2%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250707-01225_e239e038-0ba3-4699-b6b4-19d994c0e7f4	100.0%	100.0%	100.0%	0.3%	8.9%	99.7%	99.0%	99.7%	0.0%	0.4%	0.2%
S-250707-01226_ddf066e1-e625-4942-814c-5fa013cd3af7	100.0%	100.0%	100.0%	0.2%	5.8%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250707-01227_4fe9d862-d64a-4fe5-adfa-848c664b5de7	100.0%	100.0%	100.0%	0.3%	6.5%	99.7%	99.1%	99.7%	0.0%	0.3%	0.1%
S-250707-01228_5172402e-2aba-46fb-afb1-ba20c6974b13	100.0%	100.0%	100.0%	0.2%	10.5%	99.8%	99.1%	99.7%	0.0%	0.3%	0.1%
S-250707-01229_5e30e739-0cc8-4531-9ff1-726b5d936fc6	100.0%	100.0%	100.0%	0.2%	8.5%	99.8%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250707-01230_ddd53f9d-0119-4983-bbc0-87eebfd68f84	100.0%	100.0%	100.0%	0.2%	6.6%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250707-01235_f95142f7-1b94-42e4-8586-b928047ab9c8	100.0%	100.0%	100.0%	0.2%	4.8%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250709-00653_9e4dc10d-af1c-4cff-8c43-30f8740f713f	100.0%	100.0%	100.0%	0.2%	5.4%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250711-00769_dc641885-5093-4b53-83e6-a927cfcdeee0	100.0%	100.0%	100.0%	0.2%	4.9%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250711-00770_4d0e82c3-c188-40bd-a959-c9e7f02b26f0	100.0%	100.0%	100.0%	0.2%	5.9%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250711-00777_fcf3eb86-6823-44c4-b1cc-4f5253154de4	100.0%	100.0%	100.0%	0.3%	6.5%	99.7%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250711-00784_6ecfdd3a-e4d3-46fd-bd2d-1e9852bcfaa4	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250711-00792_d3aaaf9d-f987-48bc-851d-79709a612967	100.0%	100.0%	100.0%	0.2%	7.7%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250711-00800_fa7e87ff-c30d-4c2f-8e65-10ae4372b964	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250711-00814_9ef89c8f-26ba-4692-a778-4f7fcbec27ca	100.0%	100.0%	100.0%	0.3%	6.9%	99.7%	99.2%	99.7%	0.0%	0.3%	0.2%
S-250711-00830_94a5317f-9cdc-411d-b4f2-bff28582ad82	100.0%	100.0%	100.0%	0.2%	7.1%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250711-00837_a63f0fbf-800d-4220-be05-9b3fd118bc70	100.0%	100.0%	100.0%	0.2%	7.3%	99.8%	99.3%	99.7%	0.0%	0.3%	0.1%
S-250711-00844_ac0fb391-2fb2-44e4-971e-3c7f0333d454	100.0%	100.0%	100.0%	0.3%	9.6%	99.7%	99.0%	99.7%	0.0%	0.4%	0.2%
S-250714-00495_59d70165-546e-4bc1-8486-22db13fad321	100.0%	100.0%	100.0%	0.2%	8.7%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250714-00829_c0c03acd-e0c0-423c-bd12-5c2a3c1bf8e6	100.0%	100.0%	100.0%	0.3%	8.7%	99.7%	99.0%	99.7%	0.0%	0.3%	0.2%
S-250714-00830_07459a3a-57eb-4354-9eec-8205b07c1251	100.0%	100.0%	100.0%	0.3%	6.8%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250714-00831_19ba6f99-02ef-4a18-9301-20c7d42fb2bf	100.0%	100.0%	100.0%	0.2%	6.3%	99.8%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250714-00832_4de3ce50-163b-4589-979e-a949e5e30e38	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250714-00833_ee920a60-a966-4ce1-b943-57680171848f	100.0%	100.0%	100.0%	0.2%	4.8%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250714-00834_a0dafcb9-7967-45f8-b9c5-f579f12f5559	100.0%	100.0%	100.0%	0.2%	5.5%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250714-00835_3a626437-9548-4772-a710-1e212ad75a90	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250714-00836_3592fc0f-b1a3-43e9-a167-9e6d1f59372b	100.0%	100.0%	100.0%	0.2%	5.1%	99.8%	99.3%	99.7%	0.0%	0.3%	0.1%
S-250714-00837_70a60fdf-b598-497f-9a07-23a890a3583f	100.0%	100.0%	100.0%	0.2%	7.1%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250714-00838_d1cb4f4d-9536-4eb6-8ba0-8bb88cf12272	100.0%	100.0%	100.0%	0.2%	6.5%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250806-00453_a69fbaae-8e0b-4fdc-aae6-58e2387449ac	100.0%	100.0%	100.0%	0.1%	5.9%	99.9%	99.5%	99.8%	0.0%	0.1%	0.1%
S-250806-00458_d19a2b30-fb63-42de-8805-42c28c5911bd	100.0%	100.0%	100.0%	0.1%	4.9%	99.9%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250808-00180_a94c3aa1-4e54-4ecd-b90f-1af2fd6587cb	100.0%	100.0%	99.9%	0.1%	7.2%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250808-01397_598be49b-3128-4226-96c0-04da92808866	100.0%	100.0%	99.9%	0.1%	6.5%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250808-01457_1fc94014-3574-45f1-8643-fbd5f7bbcacd	100.0%	100.0%	100.0%	0.1%	6.4%	99.9%	99.5%	99.8%	0.0%	0.1%	0.1%
S-250808-01486_78dec13c-0661-4900-9907-b13f5a0bf9e3	100.0%	100.0%	99.9%	0.1%	7.7%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250814-00600_f5736333-1c1c-40f7-999f-74e13eba3e6c	100.0%	100.0%	100.0%	0.1%	4.3%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250814-00606_7cf890c7-4a38-471d-8db7-001f935a091b	100.0%	100.0%	99.9%	0.1%	6.5%	99.9%	99.2%	99.8%	0.0%	0.1%	0.1%
S-250814-00618_27488b61-6d9f-4a6c-aea4-ec9b26e0b36c	100.0%	100.0%	99.9%	0.1%	8.0%	99.9%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250814-00629_d7f1b318-d84d-4a76-b671-925e74e681c7	100.0%	100.0%	100.0%	0.1%	5.3%	99.9%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250814-00732_62280390-e28d-4a64-97ee-d6a13f0fc280	100.0%	100.0%	99.9%	0.1%	9.0%	99.9%	98.9%	99.8%	0.0%	0.1%	0.1%
S-250819-00049_9b1d8272-0fcb-4f1f-9f04-6174c130027d	100.0%	100.0%	99.9%	0.1%	4.9%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250820-00433_10efaca3-fabc-4fc5-be4b-20f1a7603f89	100.0%	100.0%	99.9%	0.1%	8.5%	99.9%	99.2%	99.8%	0.0%	0.1%	0.1%
S-250820-00481_63364e56-8f5d-45b1-88ba-6502dbd98c8e	100.0%	100.0%	99.9%	0.1%	9.0%	99.9%	98.9%	99.8%	0.0%	0.1%	0.1%
S-250820-00482_49523f4b-a24f-460b-a50b-10a58a77eb0a	100.0%	100.0%	99.9%	0.1%	7.1%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250820-00483_45a4e3cb-72ac-4912-9d06-805c42b79a82	100.0%	100.0%	99.9%	0.1%	9.2%	99.9%	99.1%	99.8%	0.0%	0.1%	0.1%
S-250820-00484_a807be4b-5ac5-4163-b1a5-3fbf63b58cca	100.0%	100.0%	100.0%	0.1%	5.0%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250820-00485_eddf9666-e661-457a-b139-e1f03b690a07	100.0%	100.0%	100.0%	0.1%	6.4%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250820-00486_e5974009-5bff-44cd-9b0f-5db9dcc3cba8	100.0%	100.0%	100.0%	0.1%	6.3%	99.9%	99.2%	99.8%	0.0%	0.1%	0.1%
S-250822-00209_2dd76a00-a9a5-4703-b6ae-feb1d5b82ce2	100.0%	100.0%	99.9%	0.1%	7.4%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00210_af636a80-a80d-4012-af84-ef8afe957595	100.0%	100.0%	100.0%	0.1%	5.6%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00211_f789a847-cd56-4cfd-a4ec-c373f9bb5e23	100.0%	100.0%	100.0%	0.1%	6.4%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00212_c1da616e-bd7e-4e6d-9a66-157b74cedcac	100.0%	100.0%	100.0%	0.1%	6.5%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00213_d2ac3f81-dbcf-4c66-b1f3-1e4044e3397c	100.0%	100.0%	100.0%	0.1%	6.4%	99.9%	99.2%	99.8%	0.0%	0.1%	0.1%
S-250822-00214_4d86a88c-b94b-40c9-a2c2-758a9e4d5e25	100.0%	100.0%	99.9%	0.1%	6.1%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00215_8dfb0694-a0ca-40c0-a211-8c17b3f4a5fc	100.0%	100.0%	100.0%	0.1%	6.5%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00216_d0b4bec8-159f-4d5e-a1d1-1fc332a02c83	100.0%	100.0%	100.0%	0.1%	6.6%	99.9%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250822-00217_49d2839c-4d06-4169-a788-97b27c304f62	100.0%	100.0%	100.0%	0.1%	5.5%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00218_fc713823-ad3b-4a50-899a-81bce7b43d1f	100.0%	100.0%	100.0%	0.1%	5.6%	99.9%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250822-00219_36b8edd5-fef8-41d4-a208-dbfbac3c9b09	100.0%	100.0%	100.0%	0.1%	6.2%	99.9%	99.2%	99.8%	0.0%	0.1%	0.1%
S-250822-00220_11f97cf7-03f1-4400-a3bb-46bc02340222	100.0%	100.0%	100.0%	0.1%	6.6%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00221_1040936e-8f70-4aba-a77f-ca39d6001358	100.0%	100.0%	100.0%	0.1%	6.2%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00222_4662c7ab-83c5-4609-9a2a-0ab9aa79fe4d	100.0%	100.0%	100.0%	0.1%	6.4%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00223_240640c0-03aa-44a1-a3c4-54f4b78b6529	100.0%	100.0%	100.0%	0.1%	6.5%	99.9%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250822-00224_950529bd-92d1-40fa-a2e1-11d6ec5fc8f7	100.0%	100.0%	100.0%	0.1%	5.4%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00225_67a53117-78ab-411b-8f46-4e30f440fa90	100.0%	100.0%	100.0%	0.1%	5.1%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00226_0ead66c4-62eb-4c8d-b539-b354b4d41341	100.0%	100.0%	100.0%	0.1%	4.6%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00227_3c8dcbc9-4b61-45ef-87d9-02c196d7fa22	100.0%	100.0%	100.0%	0.1%	4.9%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00228_77d5fe15-72df-4d26-8d8e-e7139ab594e7	100.0%	100.0%	99.9%	0.1%	7.3%	99.9%	99.2%	99.8%	0.0%	0.1%	0.1%
S-250822-00229_05422e5b-3fcf-4498-87b6-b33aa6ca1517	100.0%	100.0%	99.9%	0.1%	7.7%	99.9%	99.1%	99.8%	0.0%	0.1%	0.1%
S-250822-00230_7fee2a2e-ae47-4517-80ad-f54ae8a03935	100.0%	100.0%	99.9%	0.1%	7.3%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00231_5b125551-2b57-40ad-be8a-91ed2cb2ed56	100.0%	100.0%	100.0%	0.1%	6.4%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00232_f2803cde-bf7a-4ed8-b92c-55d94b9e8239	100.0%	100.0%	100.0%	0.1%	6.0%	99.9%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250822-00233_92a22ba1-8019-49b6-b798-cc646424008b	100.0%	100.0%	100.0%	0.1%	4.9%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00492_db4f6267-937e-424a-af7a-c8af307a146a	100.0%	100.0%	100.0%	0.1%	5.6%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00494_fe7b99b5-71be-41b3-802e-0d949dec7e4e	100.0%	100.0%	100.0%	0.1%	5.3%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00495_31040f17-7c34-4253-abe7-d140cdd41f38	100.0%	100.0%	99.9%	0.1%	8.6%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00496_d3e4ce1b-d748-4047-926c-a988768d07ad	100.0%	100.0%	100.0%	0.2%	4.8%	99.8%	99.2%	99.8%	0.0%	0.2%	0.1%
S-250822-00497_04f97331-2f4f-4258-9514-f219f21e66fb	100.0%	100.0%	100.0%	0.1%	5.4%	99.9%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250822-00498_625fc59a-f197-4378-a9ea-cc26b5b5ada1	100.0%	100.0%	100.0%	0.1%	4.9%	99.9%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250822-00499_fae4e4bf-babe-45d6-80b1-fedf25da68cf	100.0%	100.0%	100.0%	0.1%	5.4%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00500_460135da-8fe5-4870-a3d1-fc3385683709	100.0%	100.0%	100.0%	0.1%	5.8%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00501_eb0ce672-e290-4dc8-86da-da0e81582343	100.0%	100.0%	99.9%	0.1%	7.7%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00502_7c35d8ac-1773-4f27-b7c4-cae6108dcd75	100.0%	100.0%	100.0%	0.1%	5.5%	99.9%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250822-00503_14f3a6b6-6c61-408c-b7a5-cc9374ad2bb1	100.0%	100.0%	100.0%	0.1%	6.5%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00504_5b06c29d-f381-432a-a53f-eac5a97eb22c	100.0%	100.0%	100.0%	0.1%	5.0%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00505_fe6a143b-1ded-4661-9d62-bb4ea23f6d81	100.0%	100.0%	99.9%	0.1%	8.0%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00506_fcb844d3-58b4-4805-837d-893bbf64f560	100.0%	100.0%	99.9%	0.1%	6.8%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250822-00507_4f0c3fee-6955-4426-b410-8df0e29e8635	100.0%	100.0%	100.0%	0.1%	6.6%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250822-00508_5c6f7ef9-50a3-445e-8d0a-61066995373e	100.0%	100.0%	100.0%	0.1%	6.5%	99.9%	99.5%	99.8%	0.0%	0.1%	0.0%
S-250822-00872_ff04e58d-3061-4bb4-b306-f225c7386b9d	100.0%	100.0%	100.0%	0.1%	4.9%	99.9%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250825-00001_d191a398-563a-4643-8895-9768746ccbe6	100.0%	100.0%	100.0%	0.1%	5.4%	99.9%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250827-00660_67f1c844-90f0-45cb-8d21-05586839dbce	100.0%	100.0%	99.9%	0.1%	8.0%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250827-00667_2d886e3a-05ec-440d-ae76-046c89304896	100.0%	100.0%	100.0%	0.1%	6.4%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250827-00674_d1f9b133-592a-42c5-88d7-6464c212d58e	100.0%	100.0%	100.0%	0.1%	5.9%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250827-00681_75f7043d-7d14-46ef-9ef7-3ddcab771780	100.0%	100.0%	100.0%	0.2%	4.0%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250827-00688_74e73f4c-6c9f-4c19-89b9-2e619195e51a	100.0%	100.0%	99.9%	0.1%	7.2%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250827-00695_aedc1869-a08d-4986-93fa-8fef0f09c5e6	100.0%	100.0%	100.0%	0.4%	8.9%	99.6%	98.9%	99.6%	0.0%	0.3%	0.2%
S-250827-00702_995aea88-65e8-4f18-9fb1-c1a4a54e6e43	100.0%	100.0%	99.9%	0.1%	6.9%	99.9%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250827-00709_a416d61d-5743-4997-bb66-00afbfd10957	100.0%	100.0%	100.0%	0.2%	4.4%	99.8%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250827-00716_58befaa6-0add-4149-9e70-e4cc72f689f4	100.0%	100.0%	100.0%	0.1%	4.8%	99.9%	99.5%	99.8%	0.0%	0.1%	0.1%
S-250827-00723_699dd683-bacb-4baa-a16d-969a15a9f3c9	100.0%	100.0%	99.9%	0.1%	7.2%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250827-00730_cdb8bd18-8729-41b3-a9d8-3cbde32801f1	100.0%	100.0%	100.0%	0.1%	5.4%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250827-00737_5f2fb90a-f6b9-4882-835c-64bed0d3b7aa	100.0%	100.0%	100.0%	0.1%	5.3%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250827-00744_25253aa3-0561-4205-8381-20b167018313	100.0%	100.0%	100.0%	0.2%	8.4%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250827-00751_cd483f87-fc97-43f8-9aec-218fde814bf7	100.0%	100.0%	100.0%	0.1%	5.0%	99.9%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250827-00758_f4dbf8e7-1283-4105-9c2e-341ab79dcb70	100.0%	100.0%	100.0%	0.1%	5.7%	99.9%	99.5%	99.8%	0.0%	0.1%	0.1%
S-250827-00765_5e780dc4-3bb8-4b99-8f7e-dd96120493f5	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250827-00772_c3a75258-9dcc-4364-be0c-5a5940aaa89a	100.0%	100.0%	100.0%	0.2%	6.6%	99.8%	99.2%	99.8%	0.0%	0.2%	0.1%
S-250827-00779_e2bd783f-69cf-471c-a8f0-cdafd8810f0f	100.0%	100.0%	100.0%	0.3%	7.4%	99.7%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250827-01007_66438e3a-d7ca-43f6-a6f5-f313e65940dc	100.0%	100.0%	100.0%	0.1%	5.3%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250827-01012_880d529c-ab2e-46c6-96d0-3602fb8d4e37	100.0%	100.0%	100.0%	0.1%	6.9%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250827-01201_55e91561-d82b-4aee-869a-8ef4acb18c40	100.0%	100.0%	100.0%	0.1%	5.4%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250827-01310_f222f790-0605-4187-bc33-598ed9a17ae3	100.0%	100.0%	100.0%	0.1%	5.0%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250827-01323_265e592f-7cbc-4129-bef3-90677181307b	100.0%	100.0%	100.0%	0.1%	6.4%	99.9%	99.1%	99.8%	0.0%	0.1%	0.1%
S-250827-01330_a891878a-39cc-4d48-a396-c014d49d8a23	100.0%	100.0%	100.0%	0.1%	5.4%	99.9%	99.5%	99.8%	0.0%	0.1%	0.1%
S-250827-01337_039a23f4-7a0e-4d82-9fb8-b8427ed18779	100.0%	100.0%	100.0%	0.1%	7.0%	99.9%	99.3%	99.8%	0.0%	0.1%	0.1%
S-250827-01345_0e9b2346-2e96-4bd4-ac47-cc926ecac44f	100.0%	100.0%	100.0%	0.2%	5.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250827-01352_f7f1e473-9a23-40cb-8ead-6b5f119e8c84	100.0%	100.0%	100.0%	0.1%	5.0%	99.9%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250827-01359_46449f60-2787-4286-83b8-65cc34fc6ffe	100.0%	100.0%	100.0%	0.1%	6.2%	99.9%	99.2%	99.8%	0.0%	0.1%	0.1%
S-250829-00121_f59bc54d-87ac-4f85-acc7-127a9a628ae3	100.0%	100.0%	100.0%	0.1%	6.4%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250829-00149_1540e264-eb7b-40c6-b75a-0dee7c73dc90	100.0%	100.0%	100.0%	0.1%	5.7%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250829-00274_f7232d3b-89fb-434b-aa77-cf8319ae0c37	100.0%	100.0%	100.0%	0.1%	4.4%	99.9%	99.2%	99.8%	0.0%	0.1%	0.1%
S-250829-00275_77ba91d6-95de-4402-bdc1-b1d4003a2c6e	100.0%	100.0%	100.0%	0.1%	6.9%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250829-00276_631e548a-e780-4d78-a422-87e3bd8ccc74	100.0%	100.0%	100.0%	0.1%	5.1%	99.9%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250829-00277_da615cb9-fa8a-4de2-9f22-0cc4f4bd24ee	100.0%	100.0%	100.0%	0.1%	5.5%	99.9%	99.5%	99.8%	0.0%	0.1%	0.1%
S-250829-00278_f38805f9-2f9d-4bf4-904b-74d6b4c44a5a	100.0%	100.0%	100.0%	0.2%	5.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250829-00279_36ea5bb7-4c11-41d4-aacf-b6c999e095c6	100.0%	100.0%	100.0%	0.2%	4.8%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250829-00280_6129aed7-cb60-45cd-a640-654d3cadafcc	100.0%	100.0%	100.0%	0.2%	8.1%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250902-00424_a66c1e49-594e-4229-bf1f-96d8f5d1ec92	100.0%	100.0%	100.0%	0.2%	8.2%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250908-00005_516e6c1a-3dc6-46a8-af18-7574fe413c89	100.0%	100.0%	100.0%	0.2%	4.6%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250909-00166_707ebc4d-0e35-446f-a8b9-b5c7b932acec	100.0%	100.0%	100.0%	0.2%	4.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250909-00190_752b0c91-855f-4d9f-a2f5-3080c9600e6b	100.0%	100.0%	100.0%	0.2%	5.6%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250910-00496_cf867bc2-9b7a-4c9f-9ac3-00ff7a2ac77f	100.0%	100.0%	100.0%	0.1%	4.7%	99.9%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250911-00326_9b456756-25c8-4580-a103-4dbf18a64bb6	100.0%	100.0%	100.0%	0.2%	6.6%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-00327_f267470d-4cce-4caa-8acb-2ebf4d8e3ea1	100.0%	100.0%	100.0%	0.2%	5.2%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-00328_e07e4878-98b1-4092-9801-15ab5daec151	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250911-00329_e3499bac-a9ea-4b00-a8c3-cb61b1cd0b76	100.0%	100.0%	100.0%	0.2%	6.1%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-00330_9874d58c-df05-448c-939e-93cb64a3cbea	100.0%	100.0%	100.0%	0.2%	5.8%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-00331_4ed2083c-51c6-417c-a6d1-e0d44ad9f22d	100.0%	100.0%	100.0%	0.2%	5.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-00332_f3195b50-3185-4f64-806a-0ec92b5a49ca	100.0%	100.0%	100.0%	0.2%	6.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-00333_38036a77-0995-4fef-b50a-9534fad64f6c	100.0%	100.0%	100.0%	0.2%	7.5%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-00334_4dbb50dd-0e36-4d2f-af29-5d6890ac7fe5	100.0%	100.0%	100.0%	0.2%	4.7%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250911-00335_d27e6575-ebb1-4aa3-a4d2-c0f2ebd69085	100.0%	100.0%	100.0%	0.2%	5.5%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-00336_daeca8d1-5f75-4872-a818-9166bab42b87	100.0%	100.0%	100.0%	0.2%	6.1%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-00337_4dc432f7-5979-4f14-b616-518bf11c2f94	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250911-00338_1ef16eb7-2088-4afe-93c2-da6a07e786dd	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-00339_341ef06b-33d3-488a-a96d-fa60dd281053	100.0%	100.0%	100.0%	0.3%	7.2%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250911-00340_20ba413d-9840-4581-adbe-125c7529482d	100.0%	100.0%	100.0%	0.2%	6.5%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-00341_35e73857-ba04-4c88-8339-81f2a748b407	100.0%	100.0%	100.0%	0.3%	7.1%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250911-00342_7f6c7680-37a2-4e0e-8296-7dcc652c21fb	100.0%	100.0%	100.0%	0.3%	8.2%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250911-00343_3863b041-712f-4e58-8ef1-453e483122dc	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-00344_1f662520-9581-42b7-aef7-6dc6f052bea5	100.0%	100.0%	100.0%	0.2%	4.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-00345_2395ec3f-b295-420e-8f5a-6769446d747c	100.0%	100.0%	100.0%	0.2%	5.6%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-00346_1b2a079e-9af2-4faf-8b4d-3e8936d89b8a	100.0%	100.0%	100.0%	0.2%	3.2%	99.8%	98.6%	99.7%	0.0%	0.2%	0.1%
S-250911-00347_245e635b-471b-4aaf-854c-cc5f158db645	100.0%	100.0%	100.0%	0.2%	5.7%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01190_ef232f01-a960-43e3-995e-c43619107969	100.0%	100.0%	100.0%	0.2%	5.2%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-01197_b270fa73-dca7-431e-9b9f-1c77ce535d11	100.0%	100.0%	100.0%	0.2%	7.1%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01205_d263982c-da91-435a-8ada-e458715070c9	100.0%	100.0%	100.0%	0.2%	6.3%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01242_165e3da3-870a-49e3-9761-499e36ef451a	100.0%	100.0%	100.0%	0.2%	5.1%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01249_76052503-4407-4310-81d6-ec1d064cf465	100.0%	100.0%	100.0%	0.2%	6.9%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250911-01282_f7d441c7-fd77-4d32-b98b-a0d3b6233565	100.0%	100.0%	100.0%	0.2%	7.1%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01327_17c6d1c7-ac94-4e21-9ab5-debe7c428698	100.0%	100.0%	100.0%	0.2%	5.6%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01376_e00fa09c-d84e-4318-a3a9-3f7f0606cccf	100.0%	100.0%	100.0%	0.2%	7.2%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01390_69eeed35-ef3d-453e-a764-3a231815ba95	100.0%	100.0%	100.0%	0.2%	7.6%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01404_5d1924a5-df15-41b5-a626-6c195218cbe5	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01421_36f863c8-e7a2-49b4-b93f-49eb323db4a3	100.0%	100.0%	100.0%	0.2%	7.4%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01428_b5ab2187-55a9-4898-a324-dc01c16bc152	100.0%	100.0%	100.0%	0.2%	5.1%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01435_f1aea929-af7e-469f-aab8-a44bd2434b3c	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-01442_c5a7e314-5285-435f-8cfd-7f8919de7b2b	100.0%	100.0%	100.0%	0.2%	4.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01450_c3194475-9e2c-4a22-99f7-454e4d3431fa	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01458_6f9eec2f-6991-43e6-bcb9-774ca5fc71ee	100.0%	100.0%	100.0%	0.2%	6.5%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01554_384fe33c-32e3-46df-962c-b41deda2fa4c	100.0%	100.0%	100.0%	0.2%	5.9%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250911-01649_4f0c43d7-a838-4a46-9b87-1078c2f881c3	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01656_4be176a0-2efc-4bad-93e5-824857aac632	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01663_0feb6d72-04c3-41c5-9d2d-39b7d0ed0ef0	100.0%	100.0%	100.0%	0.2%	5.6%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01670_cb660229-4826-4ccd-894c-10895fcecd53	100.0%	100.0%	100.0%	0.2%	7.2%	99.8%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250911-01678_28218baa-c34d-4d1c-a024-b49b66c2bf70	100.0%	100.0%	100.0%	0.2%	4.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01685_ae766c59-667b-49d1-aeef-a67887f80169	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01698_7953357e-7c9e-4c50-99b1-653fc8c5a666	100.0%	100.0%	100.0%	0.2%	7.4%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01781_78f21026-8c68-4f77-97e2-432af0a635f3	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01792_1813488e-8dd7-4e4a-a4b7-7dfa2f8f970b	100.0%	100.0%	100.0%	0.2%	7.0%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01801_17d1ffc3-90fb-4c7d-90b7-a6c8a9bc65a7	100.0%	100.0%	100.0%	0.2%	5.5%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01808_2922ccf1-c978-4f1c-83af-c05d16efc338	100.0%	100.0%	100.0%	0.2%	5.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01815_dc4701c7-3121-4d2c-9e5c-1cb5ffda3198	100.0%	100.0%	100.0%	0.2%	6.7%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01822_440f0e3a-8d50-4ef5-9cde-f3fe966ad752	100.0%	100.0%	100.0%	0.2%	4.5%	99.8%	99.2%	99.8%	0.0%	0.2%	0.1%
S-250911-01840_dd8c9bd8-8ea7-485a-887e-fc289fe5b3a6	100.0%	100.0%	100.0%	0.2%	6.3%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250911-01847_74c130aa-4a2c-45cb-8ba4-9374fa072cd6	100.0%	100.0%	100.0%	0.2%	6.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01876_50626fab-3e63-4b9b-8acf-a055692f7418	100.0%	100.0%	100.0%	0.2%	6.9%	99.8%	99.2%	99.8%	0.0%	0.3%	0.1%
S-250911-01883_599437b2-67a1-4f84-ac2d-c09a64c2201c	100.0%	100.0%	100.0%	0.2%	6.2%	99.8%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250911-01890_2395bcac-ab58-4af1-995e-30a9e7010893	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01903_d9447f37-f45e-4ea0-82ef-da557ea0711a	100.0%	100.0%	100.0%	0.2%	8.2%	99.8%	99.4%	99.7%	0.0%	0.2%	0.1%
S-250911-01904_502feeac-e3ef-4617-b3de-8e69321f6bce	100.0%	100.0%	100.0%	0.2%	8.3%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01911_33fea3f2-9159-47f5-9aba-ea70b1f0abc4	100.0%	100.0%	100.0%	0.2%	7.6%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-01918_d285ad43-4569-412b-b8c0-f651c2f10146	100.0%	100.0%	100.0%	0.2%	5.4%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-01925_e40ac63e-daed-45cb-9be1-0466f0dffec0	100.0%	100.0%	99.9%	0.2%	10.6%	99.8%	99.1%	99.7%	0.0%	0.2%	0.1%
S-250911-01933_23b3ed5e-2623-4f38-a718-d80400372648	100.0%	100.0%	100.0%	0.3%	8.9%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250911-01968_6a1942d9-e252-4408-8554-5813bc907e03	100.0%	100.0%	100.0%	0.2%	6.3%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-02235_d260d3f4-4417-4d7b-9a54-02460ca89ba5	100.0%	100.0%	100.0%	0.2%	4.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-02256_7187b781-5f06-4394-9830-d826082fc638	100.0%	100.0%	100.0%	0.2%	7.4%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-02271_45913be2-e3a0-4dcc-a656-d42f48441d56	100.0%	100.0%	100.0%	0.2%	4.8%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-02295_54896c3c-ff6c-4f89-a50e-cbf97879b7f4	100.0%	100.0%	100.0%	0.2%	6.1%	99.8%	99.3%	99.8%	0.0%	0.3%	0.2%
S-250911-02305_f54cf07b-98ac-4233-83a8-5c3b073c393b	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-02312_25dc639d-1a91-439d-8399-2aea4835741f	100.0%	100.0%	100.0%	0.2%	7.1%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-02319_86ff5a41-aafd-46be-8ad1-e5c392981acb	100.0%	100.0%	100.0%	0.2%	6.1%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-02326_9e5610c7-0b55-456d-8930-ba9fb7a06063	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.3%	99.7%	0.0%	0.3%	0.1%
S-250911-02340_1c18c484-d9e2-4036-a978-95568a5c4bb9	100.0%	100.0%	99.9%	0.1%	4.0%	99.9%	99.4%	99.7%	0.0%	0.1%	0.1%
S-250911-02348_a41ceded-9c02-4dec-94f5-c3999a1a3090	100.0%	100.0%	100.0%	0.2%	5.3%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250911-02355_8fd6e54c-b2bd-45e5-a02d-ce6d93b9d963	100.0%	100.0%	100.0%	0.2%	6.1%	99.8%	99.2%	99.7%	0.0%	0.2%	0.1%
S-250911-02362_24097176-d87d-4610-b45c-69a6ad568922	100.0%	100.0%	100.0%	0.2%	5.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250911-02384_5c29a978-a545-46d2-972f-1befbdf421e1	100.0%	100.0%	100.0%	0.2%	4.8%	99.8%	99.4%	99.8%	0.0%	0.1%	0.1%
S-250911-02392_54521ea1-7209-47ef-9383-9fe7d85ba90e	100.0%	100.0%	100.0%	0.2%	4.9%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250911-02393_91de935f-df63-4390-bad3-0e994db18e00	100.0%	100.0%	100.0%	0.2%	6.3%	99.8%	99.3%	99.7%	0.0%	0.2%	0.1%
S-250915-02746_0819225d-a1c6-476a-8ee5-946d915548e8	100.0%	100.0%	100.0%	0.2%	7.0%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250915-02958_25612c12-25ee-4268-8a10-b2e381b277d1	100.0%	100.0%	100.0%	0.2%	6.9%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250915-03181_d7ff49ee-fb0d-4049-89f4-d3dd014f6454	100.0%	100.0%	100.0%	0.2%	4.5%	99.8%	99.3%	99.8%	0.0%	0.3%	0.1%
S-250915-03227_537c8c90-4e44-4a86-b3ec-8de8881e0981	100.0%	100.0%	100.0%	0.2%	6.0%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250915-03241_d69f7256-a1f7-42d3-9128-638155f5ffc1	100.0%	100.0%	100.0%	0.2%	7.2%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250915-03248_c64dc66d-9fc2-4955-955f-39513e8e2792	100.0%	100.0%	100.0%	0.2%	7.0%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250915-03555_8ab1c789-3606-4b9e-a873-c4bad740eb6b	100.0%	100.0%	100.0%	0.2%	6.3%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250915-03570_e430cba4-4dc5-4bc3-9003-da8a90b660aa	100.0%	100.0%	100.0%	0.2%	6.6%	99.8%	99.4%	99.8%	0.0%	0.2%	0.1%
S-250922-00768_109f57ea-f77d-445b-bca5-41f549f247a4	100.0%	100.0%	100.0%	0.2%	5.7%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250922-01023_92271428-ee07-4489-a2c3-824c3a9c0dd1	100.0%	100.0%	100.0%	0.2%	7.4%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250922-01030_f8289268-c00f-421c-9b36-d9607233de00	100.0%	100.0%	100.0%	0.2%	8.7%	99.8%	99.3%	99.7%	0.0%	0.3%	0.1%
S-250922-01044_cb39c382-47ed-4388-8544-1dbea5387b83	100.0%	100.0%	100.0%	0.2%	6.8%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250922-01190_257c3947-a4e9-4532-871a-090aa988c058	100.0%	100.0%	100.0%	0.3%	9.8%	99.7%	99.2%	99.7%	0.0%	0.3%	0.1%
S-250922-01232_0377dad3-982d-4678-a846-efe9db9a0bc7	100.0%	100.0%	100.0%	0.2%	5.5%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250922-01240_27d8ef1a-42c8-4f4a-a068-4999c21a9cfa	100.0%	100.0%	100.0%	0.2%	8.8%	99.8%	99.3%	99.8%	0.0%	0.2%	0.1%
S-250922-01455_c384ac8c-f1c4-4bb0-8ba2-2df1634375e0	100.0%	100.0%	100.0%	0.2%	8.6%	99.8%	99.2%	99.7%	0.0%	0.3%	0.1%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-pct-table_table

Sort	Column	Description	ID
\|\|	Total Reads	Total Reads	`flagstat_total_pct`
\|\|	Total Passed QC	Total Passed QC	`total_passed_pct`
\|\|	Mapped	Mapped	`mapped_passed_pct`
\|\|	Supplementary Alignments	Supplementary Alignments	`supplementary_passed_pct`
\|\|	Duplicates	Duplicates	`duplicates_passed_pct`
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed_pct`
\|\|	Properly Paired	Properly Paired	`properly_paired_passed_pct`
\|\|	Self and mate mapped	Self and mate mapped	`with_itself_and_mate_mapped_passed_pct`
\|\|	Singletons	Singletons	`singletons_passed_pct`
\|\|	Mate mapped to diff chr	Mate mapped to diff chr	`with_mate_mapped_to_a_different_chr_passed_pct`
\|\|	Diff chr (mapQ >= 5)	Diff chr (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed_pct`

FastQC

Version:


                      
                        0.12.1

Quality control tool for high throughput sequencing data.http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

681

8

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

689

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

$ Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

546

143

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

689

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

689

All samples have sequences of a single length (151bp)

Sequence Duplication Levels

689

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

689 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ⁴/₄ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	302	12802256	0.0733%
CTTATACACATCTCCGAGCCCACGAGACGTAGGCGAGCATCTAGTATGCC	1	51249	0.0003%
CTTATACACATCTCCGAGCCCACGAGACTCCTACGTCAATCTGGGGGGGG	1	50599	0.0003%
CTTATACACATCTCCGAGCCCACGAGACCACTAGACCAATCTGGGGGGGG	1	47775	0.0003%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc-total_percent`

Adapter Content

689

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQC	`0.12.1`

MultiQC Toolbox

Apply Highlight Samples

Rename Samples Bulk input Apply

Apply Show / Hide Samples

Explain with AI

Export Plots

Choose Plots All None

Save Settings

Load Settings

Tool Citations

About MultiQC

Report AI Summary

General Statistics

AI Summary

General Statistics: Columns

Mosdepth

Cumulative coverage distribution Help

AI Summary

Average coverage per contig

AI Summary

XY coverage

AI Summary

Picard

Variant Calling Metrics

AI Summary

Variant Calling Metrics: Columns

Variant Types Help

AI Summary

Variant Labels Help

AI Summary

Samtools

Flagstat

AI Summary

Samtools: flagstat: read count: Columns

Flagstat: Percentage of total

AI Summary

Samtools: flagstat: percentage of total: Columns

FastQC

Sequence Counts Help

AI Summary

AI Summary

AI Summary

Per Base Sequence Content Help

AI Summary

Rollover for sample name

AI Summary

AI Summary

AI Summary

AI Summary

Overrepresented sequences by sample Help

AI Summary

Top overrepresented sequences

AI Summary

FastQC: Top overrepresented sequences: Columns

AI Summary

Status Checks Help

AI Summary

Software Versions

AI Summary

Highlight Samples

Rename Samples

Show / Hide Samples

Choose Plots

Cumulative coverage distribution

Variant Types

Variant Labels

Sequence Counts

Per Base Sequence Content

Overrepresented sequences by sample

Status Checks